Mutants (Isolated)

tm2235

Allele Nametm2235
Sequence NameY110A2AL.13
CGC Namepinn-1
Worm BaseAllele Name tm2235
CGC Name pinn-1
Sequence Y110A2AL.13
Phenotypehomozygous viable. Dr. K.F. O'Connell: normal hatching, locomotion and body shape.
Mutation site52164/52165-52528/52529 (364 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(49933..50055, 50799..50905, 52115..52262, 52371..52444, 52492..52546))
Map position-9.56
Balancer
Map position of balancer
Sequence of primersExtRev:ATACGGGCCAATTTTCCAGA,IntRev:GATGTCCGATAATTCGCTGC,IntFwd:CCCTCAATGTTCGACGCATC,ExtFwd:GGCGGTTACAGTACCCCAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Del Rosario JS, Feldmann KG, Ahmed T, Amjad U, Ko B, An J, Mahmud T, Salama M, Mei S, Asemota D, Mano I.
Death Associated Protein Kinase (DAPK) -mediated neurodegenerative mechanisms in nematode excitotoxicity.
BMC Neurosci 2015 16 25 
[ PubMed ID = 25899010 ] [ RRC reference ]

Chen F, Chisholm AD, Jin Y.
Tissue-specific regulation of alternative polyadenylation represses expression of a neuronal ankyrin isoform in C. elegans epidermal development.
Development 2017 144(4) 698-707 
[ PubMed ID = 28087624 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]