Mutants (Isolated)

tm2235

Allele Nametm2235
Allele TypeNormal
Sequence NameY110A2AL.13
Gene Namepinn-1
Worm BaseAllele Name tm2235
Gene Name pinn-1
Sequence Y110A2AL.13
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K.F. O'Connell: normal hatching, locomotion and body shape.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 52164/52165-52528/52529 (364 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(49933..50055, 50799..50905, 52115..52262, 52371..52444, 52492..52546))
Map position-9.56
Balancer
Map position of balancer
Sequence of primersExtRev:ATACGGGCCAATTTTCCAGA,IntRev:GATGTCCGATAATTCGCTGC,IntFwd:CCCTCAATGTTCGACGCATC,ExtFwd:GGCGGTTACAGTACCCCAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Salzberg Y, Pechuk V, Gat A, Setty H, Sela S, Oren-Suissa M.
Synaptic Protein Degradation Controls Sexually Dimorphic Circuits through Regulation of DCC/UNC-40.
Curr Biol 2020 30(21) 4128-4141.e5 
[ PubMed ID = 32857970 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]

Chen F, Chisholm AD, Jin Y.
Tissue-specific regulation of alternative polyadenylation represses expression of a neuronal ankyrin isoform in C. elegans epidermal development.
Development 2017 144(4) 698-707 
[ PubMed ID = 28087624 ] [ RRC reference ]

Del Rosario JS, Feldmann KG, Ahmed T, Amjad U, Ko B, An J, Mahmud T, Salama M, Mei S, Asemota D, Mano I.
Death Associated Protein Kinase (DAPK) -mediated neurodegenerative mechanisms in nematode excitotoxicity.
BMC Neurosci 2015 16 25 
[ PubMed ID = 25899010 ] [ RRC reference ]