分離済み変異体

tm2182

Allele Name

tm2182

Allele Type

通常株

Sequence Name

R12B2.5

Gene Name

mdt-15

Worm Base

Allele Name

tm2182

Gene Name

mdt-15

Sequence

R12B2.5

Phenotype

homozygous viable. Dr. K.R. Yamamoto: PLoS Genetics 4, e1000021 (2008).

Mutation site

29157/29158-29635/29636 (478 bp deletion)

Chromosome

III

Putative gene structure

complement(join(28044..28142, 28221..28538, 28889..30043, 30116..30597, 30657..30880, 31104..31159))

Map position

-1.44

Balancer

qC1[nIs281]

Map position of balancer

Sequence of primers

ExtFwd:CACCCATTGATCCAGGTGTT,IntRev:CCATAGGAGCTGATGTCACA,IntFwd:AGGGGCTCCAGAACTTGGAC,ExtRev:CCTTCGCCGAAATTTCGAGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023
[ PubMed ID = 38045350 ] [ RRC reference ]

Goh GYS, Beigi A, Yan J, Doering KRS, Taubert S.
Mediator subunit MDT-15 promotes expression of propionic acid breakdown genes to prevent embryonic lethality in Caenorhabditis elegans.
G3 (Bethesda) 2023 13(6)
[ PubMed ID = 37075089 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Perez MA, Clostio AJ, Houston IR, Ruiz J, Magtanong L, Dixon SJ, Watts JL.
Ether lipid deficiency disrupts lipid homeostasis leading to ferroptosis sensitivity.
PLoS Genet 2022 18(9) e1010436
[ PubMed ID = 36178986 ] [ RRC reference ]

Chen Y, Qin Q, Luo J, Dong Y, Lin C, Chen H, Cao Y, Chen Y, Su Z.
Litchi flower essential oil balanced lipid metabolism through the regulation of DAF-2/IIS, MDT-15/SBP-1, and MDT-15/NHR-49 pathway.
Front Nutr 2022 9 934518
[ PubMed ID = 36337637 ] [ RRC reference ]

Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D.
Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids.
J Virol 2022 96(22) e0121122
[ PubMed ID = 36342299 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34236316 ] [ RRC reference ]

Mony VK, Drangowska-Way A, Albert R, Harrison E, Ghaddar A, Horak MK, Ke W, O'Rourke EJ.
Context-specific regulation of lysosomal lipolysis through network-level diverting of transcription factor interactions.
Proc Natl Acad Sci U S A 2021 118(41)
[ PubMed ID = 34607947 ] [ RRC reference ]

Venz R, Korosteleva A, Jongsma E, Ewald CY.
Combining Auxin-Induced Degradation and RNAi Screening Identifies Novel Genes Involved in Lipid Bilayer Stress Sensing in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 3921-3928
[ PubMed ID = 32958476 ] [ RRC reference ]

Shomer N, Kadhim AZ, Grants JM, Cheng X, Alhusari D, Bhanshali F, Poon AF, Lee MYY, Muhuri A, Park JI, Shih J, Lee D, Lee SV, Lynn FC, Taubert S.
Mediator subunit MDT-15/MED15 and Nuclear Receptor HIZR-1/HNF4 cooperate to regulate toxic metal stress responses in Caenorhabditis elegans.
PLoS Genet 2019 15(12) e1008508
[ PubMed ID = 31815936 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415
[ PubMed ID = 31408455 ] [ RRC reference ]

Anderson SM, Cheesman HK, Peterson ND, Salisbury JE, Soukas AA, Pukkila-Worley R.
The fatty acid oleate is required for innate immune activation and pathogen defense in Caenorhabditis elegans.
PLoS Pathog 2019 15(6) e1007893
[ PubMed ID = 31206555 ] [ RRC reference ]

Hu Q, D'Amora DR, MacNeil LT, Walhout AJM, Kubiseski TJ.
The Caenorhabditis elegans Oxidative Stress Response Requires the NHR-49 Transcription Factor.
G3 (Bethesda) 2018 8(12) 3857-3863
[ PubMed ID = 30297383 ] [ RRC reference ]

Moreno-Arriola E, El Hafidi M, Ortega-Cuéllar D, Carvajal K.
AMP-Activated Protein Kinase Regulates Oxidative Metabolism in Caenorhabditis elegans through the NHR-49 and MDT-15 Transcriptional Regulators.
PLoS One 2016 11(1) e0148089
[ PubMed ID = 26824904 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503
[ PubMed ID = 26637528 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190
[ PubMed ID = 28379943 ] [ RRC reference ]

Wu QL, Rui Q, He KW, Shen LL, Wang DY.
UNC-64 and RIC-4, the plasma membrane-associated SNAREs syntaxin and SNAP-25, regulate fat storage in nematode Caenorhabditis elegans.
Neurosci Bull 2010 26(2) 104-16
[ PubMed ID = 20332815 ] [ RRC reference ]

Schleit J, Wall VZ, Simko M, Kaeberlein M.
The MDT-15 subunit of mediator interacts with dietary restriction to modulate longevity and fluoranthene toxicity in Caenorhabditis elegans.
PLoS One 2011 6(11) e28036
[ PubMed ID = 22132200 ] [ RRC reference ]

Steimel A, Suh J, Hussainkhel A, Deheshi S, Grants JM, Zapf R, Moerman DG, Taubert S, Hutter H.
The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation.
Dev Biol 2013 377(2) 385-98
[ PubMed ID = 23458898 ] [ RRC reference ]

Qiao Y, Zhao Y, Wu Q, Sun L, Ruan Q, Chen Y, Wang M, Duan J, Wang D.
Full toxicity assessment of Genkwa Flos and the underlying mechanism in nematode Caenorhabditis elegans.
PLoS One 2014 9(3) e91825
[ PubMed ID = 24626436 ] [ RRC reference ]