Mutants (Isolated)

tm2182

Allele Nametm2182
Allele TypeBalanced
Sequence NameR12B2.5
Gene Namemdt-15
Worm BaseAllele Name tm2182
Gene Name mdt-15
Sequence R12B2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. K.R. Yamamoto: PLoS Genetics 4, e1000021 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29157/29158-29635/29636 (478 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(28044..28142, 28221..28538, 28889..30043, 30116..30597, 30657..30880, 31104..31159))
Map position-1.44
BalancerqC1[nIs281]
Map position of balancer
Sequence of primersIntFwd:AGGGGCTCCAGAACTTGGAC,ExtFwd:CACCCATTGATCCAGGTGTT,ExtRev:CCTTCGCCGAAATTTCGAGA,IntRev:CCATAGGAGCTGATGTCACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
An L, Geng B, An L, Wang Y, Zhang Z, Fu X, Chen J, Ma J.
Low molecular weight protein tyrosine phosphatase: A driver of lipid metabolic remodeling in Caenorhabditis elegans.
Int J Biol Macromol 2025 306(Pt 1) 141332 
[ PubMed ID = 39988157 ] [ RRC reference ]

Hodgkin J, Stroud D, O'Rourke D.
Mutations of nhr-49 affect C. elegans susceptibility to Yersinia biofilms.
MicroPubl Biol 2025 2025  
[ PubMed ID = 39975509 ] [ RRC reference ]

Pender CL, Dishart JG, Gildea HK, Nauta KM, Page EM, Siddiqi TF, Cheung SS, Joe L, Burton NO, Dillin A.
Perception of a pathogenic signature initiates intergenerational protection.
Cell 2025 188(3) 594-605.e10 
[ PubMed ID = 39721586 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Goh GYS, Beigi A, Yan J, Doering KRS, Taubert S.
Mediator subunit MDT-15 promotes expression of propionic acid breakdown genes to prevent embryonic lethality in Caenorhabditis elegans.
G3 (Bethesda) 2023 13(6)  
[ PubMed ID = 37075089 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Perez MA, Clostio AJ, Houston IR, Ruiz J, Magtanong L, Dixon SJ, Watts JL.
Ether lipid deficiency disrupts lipid homeostasis leading to ferroptosis sensitivity.
PLoS Genet 2022 18(9) e1010436 
[ PubMed ID = 36178986 ] [ RRC reference ]

Chen Y, Qin Q, Luo J, Dong Y, Lin C, Chen H, Cao Y, Chen Y, Su Z.
Litchi flower essential oil balanced lipid metabolism through the regulation of DAF-2/IIS, MDT-15/SBP-1, and MDT-15/NHR-49 pathway.
Front Nutr 2022 9 934518 
[ PubMed ID = 36337637 ] [ RRC reference ]

Casorla-Perez LA, Guennoun R, Cubillas C, Peng B, Kornfeld K, Wang D.
Orsay Virus Infection of Caenorhabditis elegans Is Modulated by Zinc and Dependent on Lipids.
J Virol 2022 96(22) e0121122 
[ PubMed ID = 36342299 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34236316 ] [ RRC reference ]

Mony VK, Drangowska-Way A, Albert R, Harrison E, Ghaddar A, Horak MK, Ke W, O'Rourke EJ.
Context-specific regulation of lysosomal lipolysis through network-level diverting of transcription factor interactions.
Proc Natl Acad Sci U S A 2021 118(41)  
[ PubMed ID = 34607947 ] [ RRC reference ]

Venz R, Korosteleva A, Jongsma E, Ewald CY.
Combining Auxin-Induced Degradation and RNAi Screening Identifies Novel Genes Involved in Lipid Bilayer Stress Sensing in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 3921-3928 
[ PubMed ID = 32958476 ] [ RRC reference ]

Shomer N, Kadhim AZ, Grants JM, Cheng X, Alhusari D, Bhanshali F, Poon AF, Lee MYY, Muhuri A, Park JI, Shih J, Lee D, Lee SV, Lynn FC, Taubert S.
Mediator subunit MDT-15/MED15 and Nuclear Receptor HIZR-1/HNF4 cooperate to regulate toxic metal stress responses in Caenorhabditis elegans.
PLoS Genet 2019 15(12) e1008508 
[ PubMed ID = 31815936 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415 
[ PubMed ID = 31408455 ] [ RRC reference ]

Anderson SM, Cheesman HK, Peterson ND, Salisbury JE, Soukas AA, Pukkila-Worley R.
The fatty acid oleate is required for innate immune activation and pathogen defense in Caenorhabditis elegans.
PLoS Pathog 2019 15(6) e1007893 
[ PubMed ID = 31206555 ] [ RRC reference ]

Hu Q, D'Amora DR, MacNeil LT, Walhout AJM, Kubiseski TJ.
The Caenorhabditis elegans Oxidative Stress Response Requires the NHR-49 Transcription Factor.
G3 (Bethesda) 2018 8(12) 3857-3863 
[ PubMed ID = 30297383 ] [ RRC reference ]

Moreno-Arriola E, El Hafidi M, Ortega-Cuéllar D, Carvajal K.
AMP-Activated Protein Kinase Regulates Oxidative Metabolism in Caenorhabditis elegans through the NHR-49 and MDT-15 Transcriptional Regulators.
PLoS One 2016 11(1) e0148089 
[ PubMed ID = 26824904 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503 
[ PubMed ID = 26637528 ] [ RRC reference ]