Mutants (Isolated)

tm2182

Allele Nametm2182
Sequence NameR12B2.5
CGC Namemdt-15
Worm BaseAllele Name tm2182
CGC Name mdt-15
Sequence R12B2.5
Phenotypehomozygous viable. Dr. K.R. Yamamoto: PLoS Genetics 4, e1000021 (2008).
Mutation site29157/29158-29635/29636 (478 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(28044..28142, 28221..28538, 28889..30043, 30116..30597, 30657..30880, 31104..31159))
Map position-1.44
Balancer
Map position of balancer
Sequence of primersIntRev:CCATAGGAGCTGATGTCACA,ExtFwd:CACCCATTGATCCAGGTGTT,ExtRev:CCTTCGCCGAAATTTCGAGA,IntFwd:AGGGGCTCCAGAACTTGGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Venz R, Korosteleva A, Jongsma E, Ewald CY.
Combining Auxin-Induced Degradation and RNAi Screening Identifies Novel Genes Involved in Lipid Bilayer Stress Sensing in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 3921-3928 
[ PubMed ID = 32958476 ] [ RRC reference ]

Shomer N, Kadhim AZ, Grants JM, Cheng X, Alhusari D, Bhanshali F, Poon AF, Lee MYY, Muhuri A, Park JI, Shih J, Lee D, Lee SV, Lynn FC, Taubert S.
Mediator subunit MDT-15/MED15 and Nuclear Receptor HIZR-1/HNF4 cooperate to regulate toxic metal stress responses in Caenorhabditis elegans.
PLoS Genet 2019 15(12) e1008508 
[ PubMed ID = 31815936 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415 
[ PubMed ID = 31408455 ] [ RRC reference ]

Anderson SM, Cheesman HK, Peterson ND, Salisbury JE, Soukas AA, Pukkila-Worley R.
The fatty acid oleate is required for innate immune activation and pathogen defense in Caenorhabditis elegans.
PLoS Pathog 2019 15(6) e1007893 
[ PubMed ID = 31206555 ] [ RRC reference ]

Hu Q, D'Amora DR, MacNeil LT, Walhout AJM, Kubiseski TJ.
The Caenorhabditis elegans Oxidative Stress Response Requires the NHR-49 Transcription Factor.
G3 (Bethesda) 2018 8(12) 3857-3863 
[ PubMed ID = 30297383 ] [ RRC reference ]

Moreno-Arriola E, El Hafidi M, Ortega-Cuéllar D, Carvajal K.
AMP-Activated Protein Kinase Regulates Oxidative Metabolism in Caenorhabditis elegans through the NHR-49 and MDT-15 Transcriptional Regulators.
PLoS One 2016 11(1) e0148089 
[ PubMed ID = 26824904 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503 
[ PubMed ID = 26637528 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190 
[ PubMed ID = 28379943 ] [ RRC reference ]

Wu QL, Rui Q, He KW, Shen LL, Wang DY.
UNC-64 and RIC-4, the plasma membrane-associated SNAREs syntaxin and SNAP-25, regulate fat storage in nematode Caenorhabditis elegans.
Neurosci Bull 2010 26(2) 104-16 
[ PubMed ID = 20332815 ] [ RRC reference ]

Schleit J, Wall VZ, Simko M, Kaeberlein M.
The MDT-15 subunit of mediator interacts with dietary restriction to modulate longevity and fluoranthene toxicity in Caenorhabditis elegans.
PLoS One 2011 6(11) e28036 
[ PubMed ID = 22132200 ] [ RRC reference ]

Steimel A, Suh J, Hussainkhel A, Deheshi S, Grants JM, Zapf R, Moerman DG, Taubert S, Hutter H.
The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation.
Dev Biol 2013 377(2) 385-98 
[ PubMed ID = 23458898 ] [ RRC reference ]

Qiao Y, Zhao Y, Wu Q, Sun L, Ruan Q, Chen Y, Wang M, Duan J, Wang D.
Full toxicity assessment of Genkwa Flos and the underlying mechanism in nematode Caenorhabditis elegans.
PLoS One 2014 9(3) e91825 
[ PubMed ID = 24626436 ] [ RRC reference ]

Goh GY, Martelli KL, Parhar KS, Kwong AW, Wong MA, Mah A, Hou NS, Taubert S.
The conserved Mediator subunit MDT-15 is required for oxidative stress responses in Caenorhabditis elegans.
Aging Cell 2014 13(1) 70-9 
[ PubMed ID = 23957350 ] [ RRC reference ]

Pukkila-Worley R, Feinbaum RL, McEwan DL, Conery AL, Ausubel FM.
The evolutionarily conserved mediator subunit MDT-15/MED15 links protective innate immune responses and xenobiotic detoxification.
PLoS Pathog 2014 10(5) e1004143 
[ PubMed ID = 24875643 ] [ RRC reference ]

Pang S, Lynn DA, Lo JY, Paek J, Curran SP.
SKN-1 and Nrf2 couples proline catabolism with lipid metabolism during nutrient deprivation.
Nat Commun 2014 5 5048 
[ PubMed ID = 25284427 ] [ RRC reference ]

Hou NS, Gutschmidt A, Choi DY, Pather K, Shi X, Watts JL, Hoppe T, Taubert S.
Activation of the endoplasmic reticulum unfolded protein response by lipid disequilibrium without disturbed proteostasis in vivo.
Proc Natl Acad Sci U S A 2014 111(22) E2271-80 
[ PubMed ID = 24843123 ] [ RRC reference ]

Kniazeva M, Zhu H, Sewell AK, Han M.
A Lipid-TORC1 Pathway Promotes Neuronal Development and Foraging Behavior under Both Fed and Fasted Conditions in C. elegans.
Dev Cell 2015 33(3) 260-71 
[ PubMed ID = 25892013 ] [ RRC reference ]

Taubert S, Hansen M, Van Gilst MR, Cooper SB, Yamamoto KR.
The Mediator subunit MDT-15 confers metabolic adaptation to ingested material.
PLoS Genet 2008 4(2) e1000021 
[ PubMed ID = 18454197 ] [ RRC reference ]