分離済み変異体

tm2180

Allele Nametm2180
BalanceCompleted
OutCrossNot Accepted
Sequence NameF16A11.3
Gene Nameppfr-1
Worm BaseAllele Name tm2180 (x1)
Gene Name ppfr-1
Sequence F16A11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14161/14162-15188/15189 (1027 bp deletion)
ChromosomeI
Putative gene structurecomplement(join([M04C9]21564..21632, 21677..21937, 21993..22067, 22123..22408, 22592..22673, 22720..22820, 22891..23196, 23250..23371, 23431..23491, 23610..24173, 24328..24501, 24632..24893, 25706..26083, 26654..26808, 27250..27429, 28122..28190, 27564..28006, 28243..28302, 28741..28854, [F16A11] 7999..8157, 13533..13750, 14194..14327, 14424..14601, 15091..15112))
Map position3.76
BalancerhT2,hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:CTGTCAGACTGCCCATAATC,ExtRev:CCGCGAAACACGTCGGTTAT,IntFwd:TTCGCCGAATCGCATCCCAA,IntRev:CGTTGCAGGGCGCTCTTTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]

Gomes JE, Tavernier N, Richaudeau B, Formstecher E, Boulin T, Mains PE, Dumont J, Pintard L.
Microtubule severing by the katanin complex is activated by PPFR-1-dependent MEI-1 dephosphorylation.
J Cell Biol 2013 202(3) 431-9 
[ PubMed ID = 23918937 ] [ RRC reference ]

Hsieh YW, Chang C, Chuang CF.
The microRNA mir-71 inhibits calcium signaling by targeting the TIR-1/Sarm1 adaptor protein to control stochastic L/R neuronal asymmetry in C. elegans.
PLoS Genet 2012 8(8) e1002864 
[ PubMed ID = 22876200 ] [ RRC reference ]

Han X, Gomes JE, Birmingham CL, Pintard L, Sugimoto A, Mains PE.
The role of protein phosphatase 4 in regulating microtubule severing in the Caenorhabditis elegans embryo.
Genetics 2009 181(3) 933-43 
[ PubMed ID = 19087961 ] [ RRC reference ]

Luo J, Shah S, Riabowol K, Mains PE.
The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway.
Genetics 2009 181(2) 473-82 
[ PubMed ID = 19015549 ] [ RRC reference ]