Allele Name | tm2180 |
Allele Type | バランス済 |
Sequence Name | F16A11.3 |
Gene Name | ppfr-1 |
Worm Base | Allele Name |
tm2180
|
Gene Name |
ppfr-1
|
Sequence |
F16A11.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 14161/14162-15188/15189 (1027 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join([M04C9]21564..21632, 21677..21937, 21993..22067, 22123..22408, 22592..22673, 22720..22820, 22891..23196, 23250..23371, 23431..23491, 23610..24173, 24328..24501, 24632..24893, 25706..26083, 26654..26808, 27250..27429, 28122..28190, 27564..28006, 28243..28302, 28741..28854, [F16A11] 7999..8157, 13533..13750, 14194..14327, 14424..14601, 15091..15112)) |
Map position | 3.76 |
Balancer | hT2 |
Map position of balancer | |
Sequence of primers | ExtFwd:CTGTCAGACTGCCCATAATC,ExtRev:CCGCGAAACACGTCGGTTAT,IntFwd:TTCGCCGAATCGCATCCCAA,IntRev:CGTTGCAGGGCGCTCTTTTC |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Hsieh YW, Chang C, Chuang CF. The microRNA mir-71 inhibits calcium signaling by targeting the TIR-1/Sarm1 adaptor protein to control stochastic L/R neuronal asymmetry in C. elegans. PLoS Genet 2012 8(8) e1002864
[ PubMed ID = 22876200 ]
[ RRC reference ]
|
Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M. Axon regeneration genes identified by RNAi screening in C. elegans. J Neurosci 2014 34(2) 629-45
[ PubMed ID = 24403161 ]
[ RRC reference ]
|
Gomes JE, Tavernier N, Richaudeau B, Formstecher E, Boulin T, Mains PE, Dumont J, Pintard L. Microtubule severing by the katanin complex is activated by PPFR-1-dependent MEI-1 dephosphorylation. J Cell Biol 2013 202(3) 431-9
[ PubMed ID = 23918937 ]
[ RRC reference ]
|
Luo J, Shah S, Riabowol K, Mains PE. The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway. Genetics 2009 181(2) 473-82
[ PubMed ID = 19015549 ]
[ RRC reference ]
|
Han X, Gomes JE, Birmingham CL, Pintard L, Sugimoto A, Mains PE. The role of protein phosphatase 4 in regulating microtubule severing in the Caenorhabditis elegans embryo. Genetics 2009 181(3) 933-43
[ PubMed ID = 19087961 ]
[ RRC reference ]
|
|