Home > Mutants (Isolated) > tm2167

Mutants (Isolated)

Allele Name		tm2167
Sequence Name		K09B11.1
CGC Name		pik-1
Worm Base	Allele Name	tm2167
	CGC Name	pik-1
	Sequence	K09B11.1
Phenotype		homozygous viable. Dr. Y-C. Wu: normal cell corpse number druing comma to 2-fold embryonic stage. Dr. J. Ewbank: normal induction of nlp-29 after infection by D. coniospora.
Mutation site		3429/3430-4089/4090 (660 bp deletion)
Chromosome		IV
Putative gene structure		join(831..942, 1827..2012, 2065..2233, 3199..3574, 4945..5559)
Map position		8.81
Balancer
Map position of balancer
Sequence of primers		IntFwd:CGATACACTTCGTGTAGCAA,ExtRev:GATGTGCTGCCAATTCCTTA,ExtFwd:GACACGGCGGCCATTCTATT,IntRev:CGAATATGCCCGTTGACCAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Hodgkin J. Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration. J Dev Biol 2019 7(4)   [ PubMed ID = 31771156 ] [ RRC reference ] Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M. IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses. Nature 2017 542(7639) 43-48  [ PubMed ID = 28099418 ] [ RRC reference ]