Mutants (Isolated)

tm2167

Allele Nametm2167
Sequence NameK09B11.1
CGC Namepik-1
Worm BaseAllele Name tm2167
CGC Name pik-1
Sequence K09B11.1
Phenotypehomozygous viable. Dr. Y-C. Wu: normal cell corpse number druing comma to 2-fold embryonic stage. Dr. J. Ewbank: normal induction of nlp-29 after infection by D. coniospora.
Mutation site3429/3430-4089/4090 (660 bp deletion)
ChromosomeIV
Putative gene structurejoin(831..942, 1827..2012, 2065..2233, 3199..3574, 4945..5559)
Map position8.81
Balancer
Map position of balancer
Sequence of primersIntFwd:CGATACACTTCGTGTAGCAA,ExtRev:GATGTGCTGCCAATTCCTTA,ExtFwd:GACACGGCGGCCATTCTATT,IntRev:CGAATATGCCCGTTGACCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hodgkin J.
Nematode Autotomy Requires Molting and Entails Tissue Healing without Obvious Regeneration.
J Dev Biol 2019 7(4)  
[ PubMed ID = 31771156 ] [ RRC reference ]

Chen C, Itakura E, Nelson GM, Sheng M, Laurent P, Fenk LA, Butcher RA, Hegde RS, de Bono M.
IL-17 is a neuromodulator of Caenorhabditis elegans sensory responses.
Nature 2017 542(7639) 43-48 
[ PubMed ID = 28099418 ] [ RRC reference ]