Mutants (Isolated)

tm2166

Allele Nametm2166
Sequence NameR03G5.5
CGC Namegpx-7
Worm BaseAllele Name tm2166
CGC Name gpx-7
Sequence R03G5.5
Phenotypehomozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C).
Mutation site1744/1745-ACGTTGCAGC-2691/2692 (947 bp deletion + 10 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(1877..1949, 1996..2197, 2257..2408, 2464..2618))
Map position-1.2
Balancer
Map position of balancer
Sequence of primersIntFwd:ATAACAGCAGCGCCCAACAG,ExtFwd:GTACACTCGGACAAGTCATG,IntRev:CGATTATGTCGCCATAAACC,ExtRev:CTTGAGAATCACGCGCCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC.
More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans.
Genetics 2012 192(4) 1533-42 
[ PubMed ID = 23086219 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]