Allele Name | tm2166 |
Sequence Name | R03G5.5 |
CGC Name | gpx-7 |
Worm Base | Allele Name |
tm2166
|
CGC Name |
gpx-7
|
Sequence |
R03G5.5
|
Phenotype | homozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C). |
Mutation site | 1744/1745-ACGTTGCAGC-2691/2692 (947 bp deletion + 10 bp insertion) |
Chromosome | X |
Putative gene structure | complement(join(1877..1949, 1996..2197, 2257..2408, 2464..2618)) |
Map position | -1.2 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:ATAACAGCAGCGCCCAACAG,ExtFwd:GTACACTCGGACAAGTCATG,IntRev:CGATTATGTCGCCATAAACC,ExtRev:CTTGAGAATCACGCGCCCAA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC. More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans. Genetics 2012 192(4) 1533-42
[ PubMed ID = 23086219 ]
[ RRC reference ]
|
Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y. Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans. PLoS ONE 2014 9(9) e107685
[ PubMed ID = 25243607 ]
[ RRC reference ]
|
|