| Allele Name | tm2166 |
| Allele Type | Normal |
| Sequence Name | R03G5.5 |
| Gene Name | gpx-7 |
| Worm Base | Allele Name |
tm2166
|
| Gene Name |
gpx-7
|
| Sequence |
R03G5.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C). |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 1744/1745-ACGTTGCAGC-2691/2692 (947 bp deletion + 10 bp insertion) |
| Chromosome | X |
| Putative gene structure | complement(join(1877..1949, 1996..2197, 2257..2408, 2464..2618)) |
| Map position | -1.2 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:ATAACAGCAGCGCCCAACAG,ExtFwd:GTACACTCGGACAAGTCATG,IntRev:CGATTATGTCGCCATAAACC,ExtRev:CTTGAGAATCACGCGCCCAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC.
Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy.
PLoS Genet 2019 15(12) e1008526
[ PubMed ID = 31834878 ]
[ RRC reference ]
|
Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC.
More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans.
Genetics 2012 192(4) 1533-42
[ PubMed ID = 23086219 ]
[ RRC reference ]
|
Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS One 2014 9(9) e107685
[ PubMed ID = 25243607 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.