Mutants (Isolated)

tm2164

Allele Nametm2164
Sequence NameZK40.1
CGC Nameacl-9
Worm BaseAllele Name tm2164
CGC Name acl-9
Sequence ZK40.1
Phenotypehomozygous viable
Mutation site1570/1571-CTCTTTTTATTTTT-1838/1839 (268 bp deletion + 14 bp insertion)
ChromosomeV
Putative gene structurejoin([T05h4]43084..43220, 43301..43725, 43776..44137, 44273..44423, 44473..44861)
Map position-0.14
Balancer
Map position of balancer
Sequence of primersIntRev:GGACGAGAATTGGGATGGCA,ExtFwd:CTACCTGGCATCTCTTCGAT,ExtRev:CGAGGTTTCGAGTATGCGTA,IntFwd:GCAAGACGCGACTGTGATAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gravato-Nobre MJ, Hodgkin J.
The acyltransferase gene bus-1 exhibits conserved and specific expression in nematode rectal cells and reveals pathogen-induced cell swelling.
Dev. Dyn. 2008 237(12) 3762-76 
[ PubMed ID = 19035336 ] [ RRC reference ]