| Allele Name | tm2144 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | R13F6.10 |
| Gene Name | cra-1 |
| Worm Base | Allele Name |
tm2144
|
| Gene Name |
cra-1
|
| Sequence |
R13F6.10
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. M. Colaiacovo: Plos Genetics, 4, e1000088 (2008). |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 33513/33514-34266/34267 (753 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(30595..30702, 30776..30946, 30987..31216, 31261..31615, 31664..31773, 31832..31949, 31995..32090, 32146..32315, 32364..32474, 32523..32601, 32655..32777, 32829..32927, 32975..33215, 33266..33361, 33443..33741, 33793..33889, 33943..34049, 34097..34225, 34273..34358, 34412..34463)) |
| Map position | -0.91 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:GTACCGCGGCGATTTGTGCA,ExtRev:CGTTCGAACGTGGAAAGGCT,ExtFwd:TATTGGAGGCGGCCACGAAT,IntRev:CAGATGCGCTCCACCGCTAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Rog O, Köhler S, Dernburg AF. The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors. Elife 2017 6
[ PubMed ID = 28045371 ]
[ RRC reference ]
|
Gao J, Kim HM, Elia AE, Elledge SJ, Colaiácovo MP. NatB domain-containing CRA-1 antagonizes hydrolase ACER-1 linking acetyl-CoA metabolism to the initiation of recombination during C. elegans meiosis. PLoS Genet 2015 11(3) e1005029
[ PubMed ID = 25768301 ]
[ RRC reference ]
|
Baudrimont A, Penkner A, Woglar A, Machacek T, Wegrostek C, Gloggnitzer J, Fridkin A, Klein F, Gruenbaum Y, Pasierbek P, Jantsch V. Leptotene/zygotene chromosome movement via the SUN/KASH protein bridge in Caenorhabditis elegans. PLoS Genet 2010 6(11) e1001219
[ PubMed ID = 21124819 ]
[ RRC reference ]
|
Smolikov S, Schild-Prüfert K, Colaiácovo MP. CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis. PLoS Genet 2008 4(6) e1000088
[ PubMed ID = 18535664 ]
[ RRC reference ]
|
|