Mutants (Isolated)

tm2144

Allele Nametm2144
BalanceNot Required
OutCrossNot Accepted
Sequence NameR13F6.10
Gene Namecra-1
Worm BaseAllele Name tm2144
Gene Name cra-1
Sequence R13F6.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Colaiacovo: Plos Genetics, 4, e1000088 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33513/33514-34266/34267 (753 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30595..30702, 30776..30946, 30987..31216, 31261..31615, 31664..31773, 31832..31949, 31995..32090, 32146..32315, 32364..32474, 32523..32601, 32655..32777, 32829..32927, 32975..33215, 33266..33361, 33443..33741, 33793..33889, 33943..34049, 34097..34225, 34273..34358, 34412..34463))
Map position-0.91
Balancer
Map position of balancer
Sequence of primersIntFwd:GTACCGCGGCGATTTGTGCA,ExtRev:CGTTCGAACGTGGAAAGGCT,ExtFwd:TATTGGAGGCGGCCACGAAT,IntRev:CAGATGCGCTCCACCGCTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rog O, Köhler S, Dernburg AF.
The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors.
Elife 2017 6  
[ PubMed ID = 28045371 ] [ RRC reference ]

Gao J, Kim HM, Elia AE, Elledge SJ, Colaiácovo MP.
NatB domain-containing CRA-1 antagonizes hydrolase ACER-1 linking acetyl-CoA metabolism to the initiation of recombination during C. elegans meiosis.
PLoS Genet 2015 11(3) e1005029 
[ PubMed ID = 25768301 ] [ RRC reference ]

Baudrimont A, Penkner A, Woglar A, Machacek T, Wegrostek C, Gloggnitzer J, Fridkin A, Klein F, Gruenbaum Y, Pasierbek P, Jantsch V.
Leptotene/zygotene chromosome movement via the SUN/KASH protein bridge in Caenorhabditis elegans.
PLoS Genet 2010 6(11) e1001219 
[ PubMed ID = 21124819 ] [ RRC reference ]

Smolikov S, Schild-Prüfert K, Colaiácovo MP.
CRA-1 uncovers a double-strand break-dependent pathway promoting the assembly of central region proteins on chromosome axes during C. elegans meiosis.
PLoS Genet 2008 4(6) e1000088 
[ PubMed ID = 18535664 ] [ RRC reference ]