Mutants (Isolated)

tm2139

Allele Nametm2139
Sequence NameC11E4.2
CGC Namegpx-3
Worm BaseAllele Name tm2139
CGC Name gpx-3
Sequence C11E4.2
Phenotypehomozygous viable
Mutation site3543/3544-4298/4299 (755 bp deletion)
ChromosomeX
Putative gene structurejoin(4067..4130, 4175..4330, 4377..4621, 4673..4882)
Map position1.42
Balancer
Map position of balancer
Sequence of primersIntRev:CCTTGACATAGGTACAGACT,ExtRev:GTACGAGGACATAAACTCGT,IntFwd:CGGGAAGTGACCGAAAGCAT,ExtFwd:TAGTTAGATGGGCCAGCGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]