分離済み変異体

tm2136

Allele Nametm2136
BalanceNot Required
OutCrossNot Accepted
Sequence NameC52B9.3
Gene Namecoel-1
Worm BaseAllele Name tm2136
Gene Name coel-1
Sequence C52B9.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11029/11030-ATTGAT-11586/11587 (557 bp deletion + 6 bp insertion)
ChromosomeX
Putative gene structurejoin(10497..10592, 10641..10766, 11061..11171, 11467..11663, 12643..12796, 12959..13177, 13230..13411, 13561..13711, 14666..14728)
Map position-7.82
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGTCACGTGAACTATCTCT,ExtRev:TGAATGACACCAGCCAGGTC,ExtFwd:ACGAACGGAAGGTACAAGTC,IntRev:AGGCAAGTGCGATTCGATAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Frédéric MY, Lundin VF, Whiteside MD, Cueva JG, Tu DK, Kang SY, Singh H, Baillie DL, Hutter H, Goodman MB, Brinkman FS, Leroux MR.
Identification of 526 conserved metazoan genetic innovations exposes a new role for cofactor E-like in neuronal microtubule homeostasis.
PLoS Genet 2013 9(10) e1003804 
[ PubMed ID = 24098140 ] [ RRC reference ]