Home > Mutants (Isolated) > tm2136

Mutants (Isolated)

Allele Name		tm2136
Balance		Not Required
OutCross		Not Accepted
Sequence Name		C52B9.3
Gene Name		coel-1
Worm Base	Allele Name	tm2136
	Gene Name	coel-1
	Sequence	C52B9.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		11029/11030-ATTGAT-11586/11587 (557 bp deletion + 6 bp insertion)
Chromosome		X
Putative gene structure		join(10497..10592, 10641..10766, 11061..11171, 11467..11663, 12643..12796, 12959..13177, 13230..13411, 13561..13711, 14666..14728)
Map position		-7.82
Balancer
Map position of balancer
Sequence of primers		IntFwd:CAGTCACGTGAACTATCTCT,ExtRev:TGAATGACACCAGCCAGGTC,ExtFwd:ACGAACGGAAGGTACAAGTC,IntRev:AGGCAAGTGCGATTCGATAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Murari E, Meadows D, Cuda N, Mangone M. A comprehensive analysis of 3'UTRs in Caenorhabditis elegans. Nucleic Acids Res 2024 52(13) 7523-7538  [ PubMed ID = 38917330 ] [ RRC reference ] Weng Y, Murphy CT. Male-specific behavioral and transcriptomic changes in aging C. elegans neurons. iScience 2024 27(6) 109910  [ PubMed ID = 38783998 ] [ RRC reference ] Frédéric MY, Lundin VF, Whiteside MD, Cueva JG, Tu DK, Kang SY, Singh H, Baillie DL, Hutter H, Goodman MB, Brinkman FS, Leroux MR. Identification of 526 conserved metazoan genetic innovations exposes a new role for cofactor E-like in neuronal microtubule homeostasis. PLoS Genet 2013 9(10) e1003804  [ PubMed ID = 24098140 ] [ RRC reference ]