| Allele Name | tm2133 |
| Allele Type | 通常株 |
| Sequence Name | F56E10.2 |
| Gene Name | fhod-2 |
| Worm Base | Allele Name |
tm2133
|
| Gene Name |
fhod-2
|
| Sequence |
F56E10.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 1430/1431-2113/2114 (683 bp deletion) |
| Chromosome | V |
| Putative gene structure | complement(join(82..221, 624..813, 932..1771, 2480..3445, 4437..4583, 5269..5349, 5407..5484)) |
| Map position | -20.01 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:TAGGAATGGCGGAGGCTCTT,IntFwd:GACTCTAACAGGTTCAGCTC,IntRev:AGCGCTTCCCCACTTCCATT,ExtFwd:GATCGTTCTCCGGCGGAATG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Refai O, Smit RB, Votra S, Pruyne D, Mains PE.
Tissue-Specific Functions of fem-2/PP2c Phosphatase and fhod-1/formin During Caenorhabditis elegans Embryonic Morphogenesis.
G3 (Bethesda) 2018 8(7) 2277-2290
[ PubMed ID = 29720391 ]
[ RRC reference ]
|
Mi-Mi L, Votra S, Kemphues K, Bretscher A, Pruyne D.
Z-line formins promote contractile lattice growth and maintenance in striated muscles of C. elegans.
J Cell Biol 2012 198(1) 87-102
[ PubMed ID = 22753896 ]
[ RRC reference ]
|
Mangio RS, Votra S, Pruyne D.
The canonical eIF4E isoform of C. elegans regulates growth, embryogenesis, and germline sex-determination.
Biol Open 2015 4(7) 843-51
[ PubMed ID = 25979704 ]
[ RRC reference ]
|
King RS, Maiden SL, Hawkins NC, Kidd AR 3rd, Kimble J, Hardin J, Walston TD.
The N- or C-terminal domains of DSH-2 can activate the C. elegans Wnt/beta-catenin asymmetry pathway.
Dev Biol 2009 328(2) 234-44
[ PubMed ID = 19298786 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.