Mutants (Isolated)

tm2133

Allele Nametm2133
Sequence NameF56E10.2
CGC Namefhod-2
Worm BaseAllele Name tm2133
CGC Name fhod-2
Sequence F56E10.2
Phenotypelethal or sterile. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL.
Mutation site1430/1431-2113/2114 (683 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(82..221, 624..813, 932..1771, 2480..3445, 4437..4583, 5269..5349, 5407..5484))
Map position-20.01
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:TAGGAATGGCGGAGGCTCTT,IntFwd:GACTCTAACAGGTTCAGCTC,IntRev:AGCGCTTCCCCACTTCCATT,ExtFwd:GATCGTTCTCCGGCGGAATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Refai O, Smit RB, Votra S, Pruyne D, Mains PE.
Tissue-Specific Functions of fem-2/PP2c Phosphatase and fhod-1/formin During Caenorhabditis elegans Embryonic Morphogenesis.
G3 (Bethesda) 2018 8(7) 2277-2290 
[ PubMed ID = 29720391 ] [ RRC reference ]

Mangio RS, Votra S, Pruyne D.
The canonical eIF4E isoform of C. elegans regulates growth, embryogenesis, and germline sex-determination.
Biol Open 2015 4(7) 843-51 
[ PubMed ID = 25979704 ] [ RRC reference ]

Mi-Mi L, Votra S, Kemphues K, Bretscher A, Pruyne D.
Z-line formins promote contractile lattice growth and maintenance in striated muscles of C. elegans.
J Cell Biol 2012 198(1) 87-102 
[ PubMed ID = 22753896 ] [ RRC reference ]

King RS, Maiden SL, Hawkins NC, Kidd AR 3rd, Kimble J, Hardin J, Walston TD.
The N- or C-terminal domains of DSH-2 can activate the C. elegans Wnt/beta-catenin asymmetry pathway.
Dev Biol 2009 328(2) 234-44 
[ PubMed ID = 19298786 ] [ RRC reference ]