分離済み変異体

tm2124

Allele Nametm2124
BalanceNot Required
OutCrossNot Accepted
Sequence NameF59B2.7
Gene Namerab-6.1
Worm BaseAllele Name tm2124 (x1)
Gene Name rab-6.1
Sequence F59B2.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Eimer: leaky maternal-effect lethal. Dr. C. Rongo: unable to examine GLR-1 trafficking.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12362/12363-TTA-13266/13267 (904 bp deletion + 3 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(12000..12067, 12115..12175, 12240..12333, 12381..12492, 12543..12648, 12696..12808, 12857..12920))
Map position0.08
BalancerhT2
Map position of balancer
Sequence of primersIntFwd:GGTACACTTGAGCACGATAC,ExtRev:TTAATCGTGCTGCAACGCCA,ExtFwd:CCCCCGAGTGATCTGATCAC,IntRev:GTCTCCGAACGAAGCTCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Martínez-Velázquez LA, Ringstad N.
Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer.
Proc Natl Acad Sci U S A 2018 115(3) E438-E447 
[ PubMed ID = 29282322 ] [ RRC reference ]

Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]

Zhang D, Dubey J, Koushika SP, Rongo C.
RAB-6.1 and RAB-6.2 Promote Retrograde Transport in C. elegans.
PLoS One 2016 11(2) e0149314 
[ PubMed ID = 26891225 ] [ RRC reference ]

Kimura K, Kimura A.
Rab6 is required for the exocytosis of cortical granules and the recruitment of separase to the granules during the oocyte-to-embryo transition in Caenorhabditis elegans.
J Cell Sci 2012 125(Pt 23) 5897-905 
[ PubMed ID = 22992455 ] [ RRC reference ]

Chen L, Wang Z, Ghosh-Roy A, Hubert T, Yan D, O'Rourke S, Bowerman B, Wu Z, Jin Y, Chisholm AD.
Axon regeneration pathways identified by systematic genetic screening in C. elegans.
Neuron 2011 71(6) 1043-57 
[ PubMed ID = 21943602 ] [ RRC reference ]