Mutants (Isolated)

tm2100

Allele Nametm2100
Sequence NameF26E4.12
CGC Namegpx-1
Worm BaseAllele Name tm2100
CGC Name gpx-1
Sequence F26E4.12
Phenotypehomozygous viable. Dr. M. Han: no observed plate phenotype.
Mutation site25927/25928-26311/26312 (384 bp deletion)
ChromosomeI
Putative gene structurejoin(25489..25556, 25613..25699, 26144..26480)
Map position3.9
Balancer
Map position of balancer
Sequence of primersExtRev:GGTGTCTTGCAATGCGTGAT,IntFwd:CCGCGTAATAAAAGCGCATG,ExtFwd:CACCGTTGACCGAGGTTATA,IntRev:ATGCGTGATCCAAGTAGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakamoto T, Maebayashi K, Nakagawa Y, Imai H.
Deletion of the four phospholipid hydroperoxide glutathione peroxidase genes accelerates aging in Caenorhabditis elegans.
Genes Cells 2014 19(10) 778-92 
[ PubMed ID = 25200408 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]