Allele Name | tm2088 |
Allele Type | 通常株 |
Sequence Name | K08E3.3 |
Gene Name | WBGene00010663 |
Worm Base | Allele Name |
tm2088
|
Gene Name |
WBGene00010663
|
Sequence |
K08E3.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. K. Subramaniam: slightly slower movement. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 15307/15308-15944/15945 (637 bp deletion) |
Chromosome | III |
Putative gene structure | join(14167..14295, 14596..14763, 14810..14911, 15156..15314, 15357..15472, 15522..15645, 15694..15854, 15902..16007, 16055..16259, 16305..16386, 16433..16509, 16656..16905, 17201..17352, 17487..17593, 17642..17692, 18137..18266, 18350..18524, 18574..18631) |
Map position | 21.49 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:TTGCGCAAAACGCGTTCCTA,ExtFwd:CGGTCAGCGGCTGGTAGATA,IntRev:CCCAACTTCCCTTTGCATGA,ExtRev:GATCCCCCAGATCCTCGATT |
Distributed lab | Dr. Kiyoji Nishiwaki(2006/12),Dr. Erik Jorgensen(2012/4),Dr. Antonio Colavita(2011/5),Dr. G. Scita(2006/3),Dr. D. Starr(2010/10),Dr. I. D. Chin-Sang(2006/10),Dr. Xiaochen Wang(2014/3),Dr. K. Subramaniam(2008/2),Dr. Christopher Quinn(2010/12),Dr. Rongying Zhang(2014/4),Dr. Marc Hammarlund(2010/10),Dr. Daniel Colon-Ramos(2020/12),Dr. Ikue Mori(2021/6),Dr. Eric Greer(2023/9) |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Chang YT, Dranow D, Kuhn J, Meyerzon M, Ngo M, Ratner D, Warltier K, Starr DA. toca-1 is in a novel pathway that functions in parallel with a SUN-KASH nuclear envelope bridge to move nuclei in Caenorhabditis elegans. Genetics 2013 193(1) 187-200
[ PubMed ID = 23150597 ]
[ RRC reference ]
|
Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G. Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis. PLoS Genet 2009 5(10) e1000675
[ PubMed ID = 19798448 ]
[ RRC reference ]
|
|