分離済み変異体

tm2088

Allele Nametm2088
Allele Type通常株
Sequence NameK08E3.3
Gene NameWBGene00010663
Worm BaseAllele Name tm2088
Gene Name WBGene00010663
Sequence K08E3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Subramaniam: slightly slower movement.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15307/15308-15944/15945 (637 bp deletion)
ChromosomeIII
Putative gene structurejoin(14167..14295, 14596..14763, 14810..14911, 15156..15314, 15357..15472, 15522..15645, 15694..15854, 15902..16007, 16055..16259, 16305..16386, 16433..16509, 16656..16905, 17201..17352, 17487..17593, 17642..17692, 18137..18266, 18350..18524, 18574..18631)
Map position21.49
Balancer
Map position of balancer
Sequence of primersIntFwd:TTGCGCAAAACGCGTTCCTA,ExtFwd:CGGTCAGCGGCTGGTAGATA,IntRev:CCCAACTTCCCTTTGCATGA,ExtRev:GATCCCCCAGATCCTCGATT
Distributed labDr. Kiyoji Nishiwaki(2006/12),Dr. Erik Jorgensen(2012/4),Dr. Antonio Colavita(2011/5),Dr. G. Scita(2006/3),Dr. D. Starr(2010/10),Dr. I. D. Chin-Sang(2006/10),Dr. Xiaochen Wang(2014/3),Dr. K. Subramaniam(2008/2),Dr. Christopher Quinn(2010/12),Dr. Rongying Zhang(2014/4),Dr. Marc Hammarlund(2010/10),Dr. Daniel Colon-Ramos(2020/12),Dr. Ikue Mori(2021/6),Dr. Eric Greer(2023/9)
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chang YT, Dranow D, Kuhn J, Meyerzon M, Ngo M, Ratner D, Warltier K, Starr DA.
toca-1 is in a novel pathway that functions in parallel with a SUN-KASH nuclear envelope bridge to move nuclei in Caenorhabditis elegans.
Genetics 2013 193(1) 187-200 
[ PubMed ID = 23150597 ] [ RRC reference ]

Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G.
Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.
PLoS Genet 2009 5(10) e1000675 
[ PubMed ID = 19798448 ] [ RRC reference ]