| Allele Name | tm2088 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | K08E3.3 |
| Gene Name | toca-2 |
| Worm Base | Allele Name |
tm2088
|
| Gene Name |
toca-2
|
| Sequence |
K08E3.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. K. Subramaniam: slightly slower movement. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15307/15308-15944/15945 (637 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(14167..14295, 14596..14763, 14810..14911, 15156..15314, 15357..15472, 15522..15645, 15694..15854, 15902..16007, 16055..16259, 16305..16386, 16433..16509, 16656..16905, 17201..17352, 17487..17593, 17642..17692, 18137..18266, 18350..18524, 18574..18631) |
| Map position | 21.49 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:TTGCGCAAAACGCGTTCCTA,ExtFwd:CGGTCAGCGGCTGGTAGATA,IntRev:CCCAACTTCCCTTTGCATGA,ExtRev:GATCCCCCAGATCCTCGATT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Chang YT, Dranow D, Kuhn J, Meyerzon M, Ngo M, Ratner D, Warltier K, Starr DA.
toca-1 is in a novel pathway that functions in parallel with a SUN-KASH nuclear envelope bridge to move nuclei in Caenorhabditis elegans.
Genetics 2013 193(1) 187-200
[ PubMed ID = 23150597 ]
[ RRC reference ]
|
Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G.
Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.
PLoS Genet 2009 5(10) e1000675
[ PubMed ID = 19798448 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.