Mutants (Isolated)

tm2066

Allele Nametm2066
Sequence NameY49E10.6
CGC Namehis-72
Worm BaseAllele Name tm2066
CGC Name his-72
Sequence Y49E10.6
Phenotypehomozygous viable. Dr. W.G. Kelly: fertile and appear WT. Dr. S. Henikoff: Plos Genetics 2, e97 (2006)
Mutation site38/39-1082/1083 (1044 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(284..412, 472..753))
Map position17.12
Balancer
Map position of balancer
Sequence of primersExtFwd:AACTGCGGCGGCGTGGAATA,IntFwd:GGCGTGGAATATAGTTGCTA,IntRev:GCCCCGACACCATTCGAATA,ExtRev:GACACCAATTTGGCTTCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Linden LM, Gordon KL, Pani AM, Payne SG, Garde A, Burkholder D, Chi Q, Goldstein B, Sherwood DR.
Identification of regulators of germ stem cell enwrapment by its niche in C. elegans.
Dev. Biol. 2017 429(1) 271-284 
[ PubMed ID = 28648843 ] [ RRC reference ]

Ooi SL, Priess JR, Henikoff S.
Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans.
PLoS Genet. 2006 2(6) e97 
[ PubMed ID = 16846252 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]