Mutants (Isolated)

tm2066

Allele Nametm2066
BalanceNot Required
OutCrossNot Accepted
Sequence NameY49E10.6
Gene Namehis-72
Worm BaseAllele Name tm2066
Gene Name his-72
Sequence Y49E10.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. W.G. Kelly: fertile and appear WT. Dr. S. Henikoff: Plos Genetics 2, e97 (2006)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 38/39-1082/1083 (1044 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(284..412, 472..753))
Map position17.12
Balancer
Map position of balancer
Sequence of primersExtFwd:AACTGCGGCGGCGTGGAATA,IntFwd:GGCGTGGAATATAGTTGCTA,IntRev:GCCCCGACACCATTCGAATA,ExtRev:GACACCAATTTGGCTTCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Linden LM, Gordon KL, Pani AM, Payne SG, Garde A, Burkholder D, Chi Q, Goldstein B, Sherwood DR.
Identification of regulators of germ stem cell enwrapment by its niche in C. elegans.
Dev Biol 2017 429(1) 271-284 
[ PubMed ID = 28648843 ] [ RRC reference ]

Piazzesi A, Papić D, Bertan F, Salomoni P, Nicotera P, Bano D.
Replication-Independent Histone Variant H3.3 Controls Animal Lifespan through the Regulation of Pro-longevity Transcriptional Programs.
Cell Rep 2016 17(4) 987-996 
[ PubMed ID = 27760329 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]

Ooi SL, Priess JR, Henikoff S.
Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans.
PLoS Genet 2006 2(6) e97 
[ PubMed ID = 16846252 ] [ RRC reference ]