| Allele Name | tm2066 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y49E10.6 |
| Gene Name | his-72 |
| Worm Base | Allele Name |
tm2066
|
| Gene Name |
his-72
|
| Sequence |
Y49E10.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. W.G. Kelly: fertile and appear WT. Dr. S. Henikoff: Plos Genetics 2, e97 (2006) |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 38/39-1082/1083 (1044 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(284..412, 472..753)) |
| Map position | 17.12 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AACTGCGGCGGCGTGGAATA,IntFwd:GGCGTGGAATATAGTTGCTA,IntRev:GCCCCGACACCATTCGAATA,ExtRev:GACACCAATTTGGCTTCGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Linden LM, Gordon KL, Pani AM, Payne SG, Garde A, Burkholder D, Chi Q, Goldstein B, Sherwood DR. Identification of regulators of germ stem cell enwrapment by its niche in C. elegans. Dev Biol 2017 429(1) 271-284
[ PubMed ID = 28648843 ]
[ RRC reference ]
|
Piazzesi A, Papić D, Bertan F, Salomoni P, Nicotera P, Bano D. Replication-Independent Histone Variant H3.3 Controls Animal Lifespan through the Regulation of Pro-longevity Transcriptional Programs. Cell Rep 2016 17(4) 987-996
[ PubMed ID = 27760329 ]
[ RRC reference ]
|
Wagner CR, Kuervers L, Baillie DL, Yanowitz JL. xnd-1 regulates the global recombination landscape in Caenorhabditis elegans. Nature 2010 467(7317) 839-43
[ PubMed ID = 20944745 ]
[ RRC reference ]
|
Ooi SL, Priess JR, Henikoff S. Histone H3.3 variant dynamics in the germline of Caenorhabditis elegans. PLoS Genet 2006 2(6) e97
[ PubMed ID = 16846252 ]
[ RRC reference ]
|
|