Mutants (Isolated)

tm2047

Allele Nametm2047
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK637.10
Gene Nametrxr-2
Worm BaseAllele Name tm2047
Gene Name trxr-2
Sequence ZK637.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29689/29690-C-30196/30197 (507 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(29817..30077, 30126..30262, 30309..30393, 30743..31279, 31330..31672, 32242..32390)
Map position0.03
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTCCCTCTTAATTCACAAC,ExtRev:CTGCGGCATTTGGTCCAACA,IntFwd:CCTAGTTTTCACCGGTACTA,IntRev:CTGCGATTCATCTCTTGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li W, Bandyopadhyay J, Hwaang HS, Park BJ, Cho JH, Lee JI, Ahnn J, Lee SK.
Two thioredoxin reductases, trxr-1 and trxr-2, have differential physiological roles in Caenorhabditis elegans.
Mol Cells 2012 34(2) 209-18 
[ PubMed ID = 22836943 ] [ RRC reference ]

Cacho-Valadez B, Muñoz-Lobato F, Pedrajas JR, Cabello J, Fierro-González JC, Navas P, Swoboda P, Link CD, Miranda-Vizuete A.
The characterization of the Caenorhabditis elegans mitochondrial thioredoxin system uncovers an unexpected protective role of thioredoxin reductase 2 in β-amyloid peptide toxicity.
Antioxid Redox Signal 2012 16(12) 1384-400 
[ PubMed ID = 22220943 ] [ RRC reference ]

Stenvall J, Fierro-González JC, Swoboda P, Saamarthy K, Cheng Q, Cacho-Valadez B, Arnér ES, Persson OP, Miranda-Vizuete A, Tuck S.
Selenoprotein TRXR-1 and GSR-1 are essential for removal of old cuticle during molting in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(3) 1064-9 
[ PubMed ID = 21199936 ] [ RRC reference ]