Mutants (Isolated)

tm2042

Allele Nametm2042
Sequence NameF36F2.4
CGC Namesyn-13
Worm BaseAllele Name tm2042
CGC Name syn-13
Sequence F36F2.4
Phenotypelethal or sterile
Mutation site4213/4214-A-5071/5072 (858 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(2144..2269, 2425..2520, 2664..2954, 3637..3714, 3762..3841, 3898..3997, 4506..4562))
Map position3.4
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:CCTTCAAAGACATCTCTCCC,IntFwd:CCGATACTACTTGAATAGGC,ExtRev:ATTCCTGCTTGGGAGATCAA ,IntRev:GAAAGGCCACGCACCAGCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]