Mutants (Isolated)

tm2028

Allele Nametm2028
Sequence NameF20H11.5
CGC Nameddo-3
Worm BaseAllele Name tm2028
CGC Name ddo-3
Sequence F20H11.5
Phenotypehomozygous viable
Mutation site2387/2388-2962/2963 (575 bp deletion)
ChromosomeIII
Putative gene structurejoin(1821..1863, 1908..2008, 2054..2664, 2713..2833, 2877..2978, 3024..3197)
Map position-1.06
Balancer
Map position of balancer
Sequence of primersIntRev:TGGGACAAGTCCGTGATAAG,ExtRev:GGTCATGTGCCACGTGTCTT,IntFwd:CTAAGTGCATTCCTATCCCA,ExtFwd:CTCCCAAAGTCCATCTACTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Saitoh Y, Katane M, Miyamoto T, Sekine M, Sakamoto T, Imai H, Homma H.
Secreted d-aspartate oxidase functions in C. elegans reproduction and development.
FEBS J 2019 286(1) 124-138 
[ PubMed ID = 30387556 ] [ RRC reference ]

Saitoh Y, Katane M, Kawata T, Maeda K, Sekine M, Furuchi T, Kobuna H, Sakamoto T, Inoue T, Arai H, Nakagawa Y, Homma H.
Spatiotemporal localization of D-amino acid oxidase and D-aspartate oxidases during development in Caenorhabditis elegans.
Mol Cell Biol 2012 32(10) 1967-83 
[ PubMed ID = 22393259 ] [ RRC reference ]