Mutants (Isolated)

tm2026

Allele Name

tm2026

Sequence Name

W03A3.2

CGC Name

polq-1

Worm Base

Allele Name

tm2026

CGC Name

polq-1

Sequence

W03A3.2

Phenotype

homozygous viable

Mutation site

8943/8944-9855/9856 (912 bp deletion)

Chromosome

III

Putative gene structure

complement(join(3668..3849, 4228..4437, 4489..4822, 4944..5612, 5668..5825, 6090..6318, 6365..6468, 6695..7452, 8474..8578, 9009..9147, 9281..9350, 9541..9774, 9829..9906, 10014..10292))

Map position

-1.45

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ACAGACACGTCACGCCACGT,IntFwd:CACGCCACGTTCATGTAGGA,ExtRev:CGAGATGCTGAACGGACTAA,IntRev:TTGCTAAAGGGCGTGCGCCT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

van Bostelen I, Tijsterman M.
Combined loss of three DNA damage response pathways renders C. elegans intolerant to light.
DNA Repair (Amst.) 2017 54 55-62
[ PubMed ID = 28472716 ] [ RRC reference ]

Roerink SF, van Schendel R, Tijsterman M.
Polymerase theta-mediated end joining of replication-associated DNA breaks in C. elegans.
Genome Res. 2014 24(6) 954-62
[ PubMed ID = 24614976 ] [ RRC reference ]

van Schendel R, van Heteren J, Welten R, Tijsterman M.
Genomic Scars Generated by Polymerase Theta Reveal the Versatile Mechanism of Alternative End-Joining.
PLoS Genet. 2016 12(10) e1006368
[ PubMed ID = 27755535 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864
[ PubMed ID = 28634159 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885
[ PubMed ID = 29046436 ] [ RRC reference ]

van Schendel R, Roerink SF, Portegijs V, van den Heuvel S, Tijsterman M.
Polymerase Θ is a key driver of genome evolution and of CRISPR/Cas9-mediated mutagenesis.
Nat Commun 2015 6 7394
[ PubMed ID = 26077599 ] [ RRC reference ]

Koole W, van Schendel R, Karambelas AE, van Heteren JT, Okihara KL, Tijsterman M.
A Polymerase Theta-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites.
Nat Commun 2014 5 3216
[ PubMed ID = 24496117 ] [ RRC reference ]

Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst.) 2008 7(6) 941-50
[ PubMed ID = 18472307 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9
[ PubMed ID = 24768858 ] [ RRC reference ]