Mutants (Isolated)

tm2026

Allele Name

tm2026

Balance

Not Required

OutCross

Not Accepted

Sequence Name

W03A3.2

Gene Name

polq-1

Worm Base

Allele Name

tm2026 (x1)

Gene Name

polq-1

Sequence

W03A3.2

Phenotype

homozygous viable

Mutation site

8943/8944-9855/9856 (912 bp deletion)

Chromosome

III

Putative gene structure

complement(join(3560..3849, 4228..4437, 4489..4822, 4944..5612, 5668..5825, 6090..6318, 6365..6468, 6695..7452, 8474..8578, 9009..9147, 9281..9350, 9541..9774, 9829..9906, 10014..10397, 10819..10952, 13612..13734, 14205..14847, 14898..[R12B2]568, 621..744, 795..863))

Map position

-1.45

Balancer

Map position of balancer

Sequence of primers

ExtFwd:ACAGACACGTCACGCCACGT,ExtRev:CGAGATGCTGAACGGACTAA,IntFwd:CACGCCACGTTCATGTAGGA,IntRev:TTGCTAAAGGGCGTGCGCCT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Verschuren J, van Schendel R, van Bostelen I, Verkennis AEE, Knipscheer P, Tijsterman M.
FAN1-mediated translesion synthesis and POLQ/HELQ-mediated end joining generate interstrand crosslink-induced mutations.
Nat Commun 2025 16(1) 2495
[ PubMed ID = 40082407 ] [ RRC reference ]

Wang S, Meyer DH, Schumacher B.
Inheritance of paternal DNA damage by histone-mediated repair restriction.
Nature 2023 613(7943) 365-374
[ PubMed ID = 36544019 ] [ RRC reference ]

Trivedi S, Blazícková J, Silva N.
PARG and BRCA1-BARD1 cooperative function regulates DNA repair pathway choice during gametogenesis.
Nucleic Acids Res 2022 50(21) 12291-12308
[ PubMed ID = 36478097 ] [ RRC reference ]

Hicks T, Koury E, McCabe C, Williams C, Crahan C, Smolikove S.
R-loop-induced irreparable DNA damage evades checkpoint detection in the C. elegans germline.
Nucleic Acids Res 2022 50(14) 8041-8059
[ PubMed ID = 35871299 ] [ RRC reference ]

Kamp JA, Lemmens BBLG, Romeijn RJ, Changoer SC, van Schendel R, Tijsterman M.
Helicase Q promotes homology-driven DNA double-strand break repair and prevents tandem duplications.
Nat Commun 2021 12(1) 7126
[ PubMed ID = 34880204 ] [ RRC reference ]

Suehiro Y, Yoshina S, Motohashi T, Iwata S, Dejima K, Mitani S.
Efficient collection of a large number of mutations by mutagenesis of DNA damage response defective animals.
Sci Rep 2021 11(1) 7630
[ PubMed ID = 33828169 ] [ RRC reference ]

Hefel A, Honda M, Cronin N, Harrell K, Patel P, Spies M, Smolikove S.
RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis.
Nucleic Acids Res 2021 49(4) 2005-2026
[ PubMed ID = 33476370 ] [ RRC reference ]

Kamp JA, van Schendel R, Dilweg IW, Tijsterman M.
BRCA1-associated structural variations are a consequence of polymerase theta-mediated end-joining.
Nat Commun 2020 11(1) 3615
[ PubMed ID = 32680986 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621
[ PubMed ID = 32414869 ] [ RRC reference ]

van Bostelen I, van Schendel R, Romeijn R, Tijsterman M.
Translesion synthesis polymerases are dispensable for C. elegans reproduction but suppress genome scarring by polymerase theta-mediated end joining.
PLoS Genet 2020 16(4) e1008759
[ PubMed ID = 32330130 ] [ RRC reference ]

Macaisne N, Kessler Z, Yanowitz JL.
Meiotic Double-Strand Break Proteins Influence Repair Pathway Utilization.
Genetics 2018 210(3) 843-856
[ PubMed ID = 30242011 ] [ RRC reference ]

Bertolini S, Wang B, Meier B, Hong Y, Gartner A.
Caenorhabditis elegans BUB-3 and SAN-1/MAD3 Spindle Assembly Checkpoint Components Are Required for Genome Stability in Response to Treatment with Ionizing Radiation.
G3 (Bethesda) 2017 7(12) 3875-3885
[ PubMed ID = 29046436 ] [ RRC reference ]

González-Huici V, Wang B, Gartner A.
A Role for the Nonsense-Mediated mRNA Decay Pathway in Maintaining Genome Stability in Caenorhabditis elegans.
Genetics 2017 206(4) 1853-1864
[ PubMed ID = 28634159 ] [ RRC reference ]

van Bostelen I, Tijsterman M.
Combined loss of three DNA damage response pathways renders C. elegans intolerant to light.
DNA Repair (Amst) 2017 54 55-62
[ PubMed ID = 28472716 ] [ RRC reference ]

van Schendel R, van Heteren J, Welten R, Tijsterman M.
Genomic Scars Generated by Polymerase Theta Reveal the Versatile Mechanism of Alternative End-Joining.
PLoS Genet 2016 12(10) e1006368
[ PubMed ID = 27755535 ] [ RRC reference ]

Lemmens B, van Schendel R, Tijsterman M.
Mutagenic consequences of a single G-quadruplex demonstrate mitotic inheritance of DNA replication fork barriers.
Nat Commun 2015 6 8909
[ PubMed ID = 26563448 ] [ RRC reference ]

van Schendel R, Roerink SF, Portegijs V, van den Heuvel S, Tijsterman M.
Polymerase Θ is a key driver of genome evolution and of CRISPR/Cas9-mediated mutagenesis.
Nat Commun 2015 6 7394
[ PubMed ID = 26077599 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9
[ PubMed ID = 24768858 ] [ RRC reference ]

Roerink SF, van Schendel R, Tijsterman M.
Polymerase theta-mediated end joining of replication-associated DNA breaks in C. elegans.
Genome Res 2014 24(6) 954-62
[ PubMed ID = 24614976 ] [ RRC reference ]

Koole W, van Schendel R, Karambelas AE, van Heteren JT, Okihara KL, Tijsterman M.
A Polymerase Theta-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites.
Nat Commun 2014 5 3216
[ PubMed ID = 24496117 ] [ RRC reference ]