Home > Mutants (Isolated) > tm2021

Mutants (Isolated)

Allele Name		tm2021
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F54E7.7
Gene Name		rcn-1
Worm Base	Allele Name	tm2021
	Gene Name	rcn-1
	Sequence	F54E7.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. J. Ahnn: normal locomotion.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		29802/29803-30221/30222 (419 bp deletion)
Chromosome		III
Putative gene structure		complement(join(28954..29083, 29754..30014, 30065..30177, 30226..30345))
Map position		-1.46
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CCCGCGGCAGAATAAGCTCT,IntFwd:CACATGGAGATGAAGGGCGT,ExtRev:ACCCACACTCATGCACCATG,IntRev:TCCCTTGATGGCCATGGCTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Li W, Choi TW, Ahnn J, Lee SK. Allele-Specific Phenotype Suggests a Possible Stimulatory Activity of RCAN-1 on Calcineurin in Caenorhabditis elegans. Mol Cells 2016 39(11) 827-833  [ PubMed ID = 27871170 ] [ RRC reference ] Li W, Bell HW, Ahnn J, Lee SK. Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans. J Mol Biol 2015 427(22) 3457-3468  [ PubMed ID = 26232604 ] [ RRC reference ]