Mutants (Isolated)

tm2001

Allele Name

tm2001

Sequence Name

ZK1251.2

CGC Name

ins-7

Worm Base

Allele Name

tm2001

CGC Name

ins-7

Sequence

ZK1251.2

Phenotype

homozygous viable. Dr. P.W. Sternberg: normal locomotion.

Mutation site

11135/11136-A-11499/11500 (364 bp deletion + 1 bp insertion)

Chromosome

Putative gene structure

complement(join(10833..10912, 10954..11191))

Map position

4.35

Balancer

Map position of balancer

Sequence of primers

IntRev:GTCTGCAATCGCGGCTAATG,ExtRev:CCAGAGAATCAGCCGCTCGA,IntFwd:CGAGATCAGTTTGCGTAGCT,ExtFwd:CATAGCGCGAGATCAGTTTG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell 2016 39(2) 209-223
[ PubMed ID = 27720609 ] [ RRC reference ]

Harris G, Wu T, Linfield G, Choi MK, Liu H, Zhang Y.
Molecular and cellular modulators for multisensory integration in C. elegans.
PLoS Genet 2019 15(3) e1007706
[ PubMed ID = 30849079 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85
[ PubMed ID = 23395381 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330
[ PubMed ID = 28131836 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79
[ PubMed ID = 24671950 ] [ RRC reference ]

Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2007 104(48) 19046-50
[ PubMed ID = 18025456 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225
[ PubMed ID = 24675767 ] [ RRC reference ]