Mutants (Isolated)

tm2001

Allele Name

tm2001

Sequence Name

ZK1251.2

CGC Name

ins-7

Worm Base

Allele Name

tm2001

CGC Name

ins-7

Sequence

ZK1251.2

Phenotype

homozygous viable. Dr. P.W. Sternberg: normal locomotion.

Mutation site

11135/11136-A-11499/11500 (364 bp deletion + 1 bp insertion)

Chromosome

Putative gene structure

complement(join(10833..10912, 10954..11191))

Map position

4.35

Balancer

Map position of balancer

Sequence of primers

IntRev:GTCTGCAATCGCGGCTAATG,ExtRev:CCAGAGAATCAGCCGCTCGA,IntFwd:CGAGATCAGTTTGCGTAGCT,ExtFwd:CATAGCGCGAGATCAGTTTG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2007 104(48) 19046-50
[ PubMed ID = 18025456 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85
[ PubMed ID = 23395381 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79
[ PubMed ID = 24671950 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2017 484(2) 323-330
[ PubMed ID = 28131836 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225
[ PubMed ID = 24675767 ] [ RRC reference ]