Mutants (Isolated)

tm2001

Allele Nametm2001
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK1251.2
Gene Nameins-7
Worm BaseAllele Name tm2001
Gene Name ins-7
Sequence ZK1251.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P.W. Sternberg: normal locomotion.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11135/11136-A-11499/11500 (364 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(10833..10912, 10954..11191))
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntRev:GTCTGCAATCGCGGCTAATG,ExtRev:CCAGAGAATCAGCCGCTCGA,IntFwd:CGAGATCAGTTTGCGTAGCT,ExtFwd:CATAGCGCGAGATCAGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Tsai YT, Chang CH, Tsai HY.
Rege-1 promotes C. elegans survival by modulating IIS and TOR pathways.
PLoS Genet 2023 19(8) e1010869 
[ PubMed ID = 37556491 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5 
[ PubMed ID = 31676170 ] [ RRC reference ]

Harris G, Wu T, Linfield G, Choi MK, Liu H, Zhang Y.
Molecular and cellular modulators for multisensory integration in C. elegans.
PLoS Genet 2019 15(3) e1007706 
[ PubMed ID = 30849079 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Chen YC, Chen HJ, Tseng WC, Hsu JM, Huang TT, Chen CH, Pan CL.
A C. elegans Thermosensory Circuit Regulates Longevity through crh-1/CREB-Dependent flp-6 Neuropeptide Signaling.
Dev Cell 2016 39(2) 209-223 
[ PubMed ID = 27720609 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85 
[ PubMed ID = 23395381 ] [ RRC reference ]

Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2007 104(48) 19046-50 
[ PubMed ID = 18025456 ] [ RRC reference ]