Mutants (Isolated)

tm2001

Allele Nametm2001
Sequence NameZK1251.2
CGC Nameins-7
Worm BaseAllele Name tm2001
CGC Name ins-7
Sequence ZK1251.2
Phenotypehomozygous viable. Dr. P.W. Sternberg: normal locomotion.
Mutation site11135/11136-A-11499/11500 (364 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(10833..10912, 10954..11191))
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntRev:GTCTGCAATCGCGGCTAATG,ExtRev:CCAGAGAATCAGCCGCTCGA,IntFwd:CGAGATCAGTTTGCGTAGCT,ExtFwd:CATAGCGCGAGATCAGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2007 104(48) 19046-50 
[ PubMed ID = 18025456 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85 
[ PubMed ID = 23395381 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]