Mutants (Isolated)

tm1992

Allele Nametm1992
BalanceNot Required
OutCrossNot Accepted
Sequence NameT14F9.3
Gene Namehex-1
Worm BaseAllele Name tm1992
Gene Name hex-1
Sequence T14F9.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I. Wilson: J. Biol. Chem. 282, 27825 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18746/18747-20098/20099 (1352 bp deletion)
ChromosomeX
Putative gene structurejoin(18470..18568, 18613..18739, 18793..18918, 18964..19079, 19421..19633, 19677..19907, 19952..20127, 20175..20435, 20477..20599, 21300..21495)
Map position-16.32
Balancer
Map position of balancer
Sequence of primersIntRev:GCGGACACAATCACTGGGAA,ExtRev:CAAGTACCAGCACGCGGACA,IntFwd:CCCATACTTATATTCGCCCT,ExtFwd:CCGTTTCACGATCTAAGCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gutternigg M, Kretschmer-Lubich D, Paschinger K, Rendić D, Hader J, Geier P, Ranftl R, Jantsch V, Lochnit G, Wilson IB.
Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.
J Biol Chem 2007 282(38) 27825-40 
[ PubMed ID = 17636254 ] [ RRC reference ]