Mutants (Isolated)

tm1988

Allele Nametm1988
BalanceNot Required
OutCrossNot Accepted
Sequence NameT01H8.2
Gene NameT01H8.2
Worm BaseAllele Name tm1988
Gene Name T01H8.2
Sequence T01H8.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21928/21929-AGTGCCC-23586/23587 (1658 bp deletion + 7 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(21269..21394, 21437..21487, 21913..22082, 22132..22261, 22315..22399, 22645..22811, 23168..23392))
Map position2.96
Balancer
Map position of balancer
Sequence of primersExtRev:TGTACCGTCGAGACGACTTG,IntRev:GCTCCTCATTGAAGCCCAAT,ExtFwd:GTGTCTTCGAACTCCCTACA,IntFwd:CCTACACTTCACCTGATCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Saitoh Y, Katane M, Miyamoto T, Sekine M, Sakai-Kato K, Homma H.
d-Serine and d-Alanine Regulate Adaptive Foraging Behavior in Caenorhabditis elegans via the NMDA Receptor.
J Neurosci 2020 40(39) 7531-7544 
[ PubMed ID = 32855271 ] [ RRC reference ]

Katane M, Saitoh Y, Uchiyama K, Nakayama K, Saitoh Y, Miyamoto T, Sekine M, Uda K, Homma H.
Characterization of a homologue of mammalian serine racemase from Caenorhabditis elegans: the enzyme is not critical for the metabolism of serine in vivo.
Genes Cells 2016 21(9) 966-77 
[ PubMed ID = 27458110 ] [ RRC reference ]