| Allele Name | tm1987 |
| Allele Type | 通常株 |
| Sequence Name | F54F3.3 |
| Gene Name | lipl-1 |
| Worm Base | Allele Name |
tm1987
|
| Gene Name |
lipl-1
|
| Sequence |
F54F3.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. J. Kaplan: slight increase in Nile Red staining. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 12770/12771-TTATATG-13301/13302 (531 bp deletion + 7 bp insertion) |
| Chromosome | V |
| Putative gene structure | join(12340..12432, 12542..12641, 12803..13431, 13479..13754, 13808..13927) |
| Map position | 4.73 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GGTTTGGTACGGTTGCAGAG,IntFwd:ACTACGACTCCTTTCCGTGA,ExtRev:GATATGCTGGCAGGATAAAG,IntRev:CCCCAGATGAAATCGAGATG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H.
A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway.
Front Immunol 2023 14 1249436
[ PubMed ID = 37928537 ]
[ RRC reference ]
|
Bai J, Zhu Y, He L, Zhang J, Li J, Pan R, Zhang J, Zhao Y, Cui L, Lu H, Jiang Y, Xiao X.
Saponins from bitter melon reduce lipid accumulation via induction of autophagy in C. elegans and HepG2 cell line.
Curr Res Food Sci 2022 5 1167-1175
[ PubMed ID = 35936825 ]
[ RRC reference ]
|
Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671
[ PubMed ID = 32009302 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.