分離済み変異体

tm1987

Allele Nametm1987
BalanceNot Required
OutCrossNot Accepted
Sequence NameF54F3.3
Gene Namelipl-1
Worm BaseAllele Name tm1987
Gene Name lipl-1
Sequence F54F3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Kaplan: slight increase in Nile Red staining.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12770/12771-TTATATG-13301/13302 (531 bp deletion + 7 bp insertion)
ChromosomeV
Putative gene structurejoin(12340..12432, 12542..12641, 12803..13431, 13479..13754, 13808..13927)
Map position4.73
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTTTGGTACGGTTGCAGAG,IntFwd:ACTACGACTCCTTTCCGTGA,ExtRev:GATATGCTGGCAGGATAAAG,IntRev:CCCCAGATGAAATCGAGATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Garcia-Sanchez JA, Bonnet E, Loubatier C, Doye A, Paillier G, Segui F, Larbret F, Chaintreuil P, Batistic L, Torre C, Deckert M, Polanowska J, Munro P, Boyer L, Visvikis O.
Evolutionary conserved regulation of TFEB stability by the E3 ubiquitin ligase WWP2 modulates response to stress in vivo.
iScience 2025 28(2) 111838 
[ PubMed ID = 39995862 ] [ RRC reference ]

Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H.
A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway.
Front Immunol 2023 14 1249436 
[ PubMed ID = 37928537 ] [ RRC reference ]

Bai J, Zhu Y, He L, Zhang J, Li J, Pan R, Zhang J, Zhao Y, Cui L, Lu H, Jiang Y, Xiao X.
Saponins from bitter melon reduce lipid accumulation via induction of autophagy in C. elegans and HepG2 cell line.
Curr Res Food Sci 2022 5 1167-1175 
[ PubMed ID = 35936825 ] [ RRC reference ]

Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]