Mutants (Isolated)

tm1981

Allele Nametm1981
Sequence NameF10G8.7
CGC Nameercc-1
Worm BaseAllele Name tm1981
CGC Name ercc-1
Sequence F10G8.7
Phenotypehomozygous viable
Mutation site24319/24320-24938/24939 (619 bp deletion)
ChromosomeI
Putative gene structurejoin(11802..11856, 23527..23756, 24439..24510, 24587..24688, 25639..25703, 27191..27310, 27642..27786)
Map position4.58
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTTCGTGAATCAGTGAGCT,IntFwd:TACCGTATTTTTGAGCGCGA,ExtRev:CCCTGGCGTAGACCTAAATA,IntRev:CGGTAGGAATTACTCTGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gurkar AU, Robinson AR, Cui Y, Li X, Allani SK, Webster A, Muravia M, Fallahi M, Weissbach H, Robbins PD, Wang Y, Kelley EE, Croix CMS, Niedernhofer LJ, Gill MS.
Dysregulation of DAF-16/FOXO3A-mediated stress responses accelerates oxidative DNA damage induced aging.
Redox Biol 2018 18 191-199 
[ PubMed ID = 30031267 ] [ RRC reference ]

Greer EL, Blanco MA, Gu L, Sendinc E, Liu J, Aristizábal-Corrales D, Hsu CH, Aravind L, He C, Shi Y.
DNA Methylation on N6-Adenine in C. elegans.
Cell 2015 161(4) 868-78 
[ PubMed ID = 25936839 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621 
[ PubMed ID = 32414869 ] [ RRC reference ]

Agostinho A, Meier B, Sonneville R, Jagut M, Woglar A, Blow J, Jantsch V, Gartner A.
Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS-81 and XPF-1 nucleases.
PLoS Genet 2013 9(7) e1003591 
[ PubMed ID = 23901331 ] [ RRC reference ]

Rossillo M, Ringstad N.
Development of specialized sensory neurons engages a nuclear receptor required for functional plasticity.
Genes Dev 2020 34(23-24) 1666-1679 
[ PubMed ID = 33184226 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]