Mutants (Isolated)

tm1978

Allele Nametm1978
Sequence NameW02C12.3
CGC Namehlh-30
Worm BaseAllele Name tm1978
CGC Name hlh-30
Sequence W02C12.3
Phenotypehomozygous viable
Mutation site11784/11785-12494/12495 (710 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(10396..10566, 11129..11205, 11271..11421, 11471..11759, 12196..12271, 12330..12474, 12670..12798, 12894..12968, 13124..13219, 13331..13618))
Map position-1.01
Balancer
Map position of balancer
Sequence of primersExtFwd:CACTATAATCTGGCGGGCTA,IntFwd:CTAGCCGATCCGACCGAGAA,ExtRev:TGGCCCGTACTCTGTTAGAA,IntRev:CCAGTGACGGCAGCGACAAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kumar S, Egan BM, Kocsisova Z, Schneider DL, Murphy JT, Diwan A, Kornfeld K.
Lifespan Extension in C. elegans Caused by Bacterial Colonization of the Intestine and Subsequent Activation of an Innate Immune Response.
Dev Cell 2019 49(1) 100-117.e6 
[ PubMed ID = 30965033 ] [ RRC reference ]

Tiku V, Kew C, Mehrotra P, Ganesan R, Robinson N, Antebi A.
Nucleolar fibrillarin is an evolutionarily conserved regulator of bacterial pathogen resistance.
Nat Commun 2018 9(1) 3607 
[ PubMed ID = 30190478 ] [ RRC reference ]

Shamalnasab M, Gravel SP, St-Pierre J, Breton L, Jäger S, Aguilaniu H.
A salicylic acid derivative extends the lifespan of Caenorhabditis elegans by activating autophagy and the mitochondrial unfolded protein response.
Aging Cell 2018 17(6) e12830 
[ PubMed ID = 30192051 ] [ RRC reference ]

Lin XX, Sen I, Janssens GE, Zhou X, Fonslow BR, Edgar D, Stroustrup N, Swoboda P, Yates JR 3rd, Ruvkun G, Riedel CG.
DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity.
Nat Commun 2018 9(1) 4400 
[ PubMed ID = 30353013 ] [ RRC reference ]

Silvestrini MJ, Johnson JR, Kumar AV, Thakurta TG, Blais K, Neill ZA, Marion SW, St Amand V, Reenan RA, Lapierre LR.
Nuclear Export Inhibition Enhances HLH-30/TFEB Activity, Autophagy, and Lifespan.
Cell Rep 2018 23(7) 1915-1921 
[ PubMed ID = 29768192 ] [ RRC reference ]

Shi C, Booth LN, Murphy CT.
Insulin-like peptides and the mTOR-TFEB pathway protect Caenorhabditis elegans hermaphrodites from mating-induced death.
Elife 2019 8  
[ PubMed ID = 31282862 ] [ RRC reference ]

Solis GM, Kardakaris R, Valentine ER, Bar-Peled L, Chen AL, Blewett MM, McCormick MA, Williamson JR, Kennedy B, Cravatt BF, Petrascheck M.
Translation attenuation by minocycline enhances longevity and proteostasis in old post-stress-responsive organisms.
Elife 2018 7  
[ PubMed ID = 30479271 ] [ RRC reference ]

Harvald EB, Sprenger RR, Dall KB, Ejsing CS, Nielsen R, Mandrup S, Murillo AB, Larance M, Gartner A, Lamond AI, Færgeman NJ.
Multi-omics Analyses of Starvation Responses Reveal a Central Role for Lipoprotein Metabolism in Acute Starvation Survival in C. elegans.
Cell Syst 2017 5(1) 38-52.e4 
[ PubMed ID = 28734827 ] [ RRC reference ]

Najibi M, Labed SA, Visvikis O, Irazoqui JE.
An Evolutionarily Conserved PLC-PKD-TFEB Pathway for Host Defense.
Cell Rep 2016 15(8) 1728-42 
[ PubMed ID = 27184844 ] [ RRC reference ]

Goh GYS, Winter JJ, Bhanshali F, Doering KRS, Lai R, Lee K, Veal EA, Taubert S.
NHR-49/HNF4 integrates regulation of fatty acid metabolism with a protective transcriptional response to oxidative stress and fasting.
Aging Cell 2018 17(3) e12743 
[ PubMed ID = 29508513 ] [ RRC reference ]

Lee SH, Omi S, Thakur N, Taffoni C, Belougne J, Engelmann I, Ewbank JJ, Pujol N.
Modulatory upregulation of an insulin peptide gene by different pathogens in C. elegans.
Virulence 2018 9(1) 648-658 
[ PubMed ID = 29405821 ] [ RRC reference ]

Butler VJ, Gao F, Corrales CI, Cortopassi WA, Caballero B, Vohra M, Ashrafi K, Cuervo AM, Jacobson MP, Coppola G, Kao AW.
Age- and stress-associated C. elegans granulins impair lysosomal function and induce a compensatory HLH-30/TFEB transcriptional response.
PLoS Genet 2019 15(8) e1008295 
[ PubMed ID = 31398187 ] [ RRC reference ]

Snoek LB, Sterken MG, Volkers RJ, Klatter M, Bosman KJ, Bevers RP, Riksen JA, Smant G, Cossins AR, Kammenga JE.
A rapid and massive gene expression shift marking adolescent transition in C. elegans.
Sci Rep 2014 4 3912 
[ PubMed ID = 24468752 ] [ RRC reference ]

Settembre C, De Cegli R, Mansueto G, Saha PK, Vetrini F, Visvikis O, Huynh T, Carissimo A, Palmer D, Klisch TJ, Wollenberg AC, Di Bernardo D, Chan L, Irazoqui JE, Ballabio A.
TFEB controls cellular lipid metabolism through a starvation-induced autoregulatory loop.
Nat Cell Biol 2013 15(6) 647-58 
[ PubMed ID = 23604321 ] [ RRC reference ]

Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, Gelino S, Ong B, Davis AE, Irazoqui JE, Dillin A, Hansen M.
The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans.
Nat Commun 2013 4 2267 
[ PubMed ID = 23925298 ] [ RRC reference ]

Visvikis O, Ihuegbu N, Labed SA, Luhachack LG, Alves AF, Wollenberg AC, Stuart LM, Stormo GD, Irazoqui JE.
Innate host defense requires TFEB-mediated transcription of cytoprotective and antimicrobial genes.
Immunity 2014 40(6) 896-909 
[ PubMed ID = 24882217 ] [ RRC reference ]

Seah NE, de Magalhaes Filho CD, Petrashen AP, Henderson HR, Laguer J, Gonzalez J, Dillin A, Hansen M, Lapierre LR.
Autophagy-mediated longevity is modulated by lipoprotein biogenesis.
Autophagy 2016 12(2) 261-72 
[ PubMed ID = 26671266 ] [ RRC reference ]

Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet 2016 12(8) e1006237 
[ PubMed ID = 27487365 ] [ RRC reference ]

Nakamura S, Karalay Ö, Jäger PS, Horikawa M, Klein C, Nakamura K, Latza C, Templer SE, Dieterich C, Antebi A.
Mondo complexes regulate TFEB via TOR inhibition to promote longevity in response to gonadal signals.
Nat Commun 2016 7 10944 
[ PubMed ID = 27001890 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J Lipid Res 2017 58(1) 72-80 
[ PubMed ID = 27884963 ] [ RRC reference ]