分離済み変異体

tm1978

Allele Nametm1978
BalanceNot Required
OutCrossNot Accepted
Sequence NameW02C12.3
Gene Namehlh-30
Worm BaseAllele Name tm1978 (x1)
Gene Name hlh-30
Sequence W02C12.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11784/11785-12494/12495 (710 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(10396..10566, 11129..11205, 11271..11421, 11471..11759, 12196..12271, 12330..12474, 12670..12798, 12894..12968, 13124..13219, 13331..13618))
Map position-1.01
BalancernT1
Map position of balancer
Sequence of primersExtFwd:CACTATAATCTGGCGGGCTA,IntFwd:CTAGCCGATCCGACCGAGAA,ExtRev:TGGCCCGTACTCTGTTAGAA,IntRev:CCAGTGACGGCAGCGACAAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Guo Y, Zhang Q, Zhang B, Pan T, Ronan EA, Huffman A, He Y, Inoki K, Liu J, Xu XZS.
Dietary cinnamon promotes longevity and extends healthspan via mTORC1 and autophagy signaling.
Aging Cell 2025 24(4) e14448 
[ PubMed ID = 39760475 ] [ RRC reference ]

Garcia-Sanchez JA, Bonnet E, Loubatier C, Doye A, Paillier G, Segui F, Larbret F, Chaintreuil P, Batistic L, Torre C, Deckert M, Polanowska J, Munro P, Boyer L, Visvikis O.
Evolutionary conserved regulation of TFEB stability by the E3 ubiquitin ligase WWP2 modulates response to stress in vivo.
iScience 2025 28(2) 111838 
[ PubMed ID = 39995862 ] [ RRC reference ]

Liu X, Chang Z, Sun P, Cao B, Wang Y, Fang J, Pei Y, Chen B, Zou W.
MONITTR allows real-time imaging of transcription and endogenous proteins in C. elegans.
J Cell Biol 2025 224(1)  
[ PubMed ID = 39400293 ] [ RRC reference ]

Das P, Aballay A, Singh J.
Calcineurin inhibition enhances Caenorhabditis elegans lifespan by defecation defects-mediated calorie restriction and nuclear hormone signaling.
Elife 2024 12  
[ PubMed ID = 39485281 ] [ RRC reference ]

Taylor SKB, Hartman JH, Gupta BP.
The neurotrophic factor MANF regulates autophagy and lysosome function to promote proteostasis in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2024 121(43) e2403906121 
[ PubMed ID = 39418305 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Horikawa M, Fukuyama M, Antebi A, Mizunuma M.
Regulatory mechanism of cold-inducible diapause in Caenorhabditis elegans.
Nat Commun 2024 15(1) 5793 
[ PubMed ID = 38987256 ] [ RRC reference ]

Tataridas-Pallas N, Aman Y, Williams R, Chapman H, Cheng KJH, Gomez-Paredes C, Bates GP, Labbadia J.
Mitochondrial clearance and increased HSF-1 activity are coupled to promote longevity in fasted Caenorhabditis elegans.
iScience 2024 27(6) 109834 
[ PubMed ID = 38784016 ] [ RRC reference ]

Shalash R, Levi-Ferber M, von Chrzanowski H, Atrash MK, Shav-Tal Y, Henis-Korenblit S.
HLH-30/TFEB rewires the chaperone network to promote proteostasis under conditions of Coenzyme A and Iron-Sulfur Cluster Deficiency.
bioRxiv 2024   
[ PubMed ID = 38895373 ] [ RRC reference ]

Metcalf MG, Monshietehadi S, Sahay A, Durieux J, Frakes AE, Velichkovska M, Mena C, Farinas A, Sanchez M, Dillin A.
Cell non-autonomous control of autophagy and metabolism by glial cells.
iScience 2024 27(4) 109354 
[ PubMed ID = 38500817 ] [ RRC reference ]

Ham S, Kim SS, Park S, Kwon HC, Ha SG, Bae Y, Lee GY, Lee SV.
Combinatorial transcriptomic and genetic dissection of insulin/IGF-1 signaling-regulated longevity in Caenorhabditis elegans.
Aging Cell 2024  e14151 
[ PubMed ID = 38529797 ] [ RRC reference ]

Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12  
[ PubMed ID = 38446031 ] [ RRC reference ]

Taylor SKB, Hartman JH, Gupta BP.
Neurotrophic factor MANF regulates autophagy and lysosome function to promote proteostasis in C. elegans.
bioRxiv 2024   
[ PubMed ID = 38260421 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Gonzalez X, Irazoqui JE.
Distinct members of the C. elegans CeMbio reference microbiota exert cryptic virulence and infection protection.
bioRxiv 2023   
[ PubMed ID = 37961109 ] [ RRC reference ]

Kumar AV, Mills J, Parker WM, Leitão JA, Rodriguez DI, Daigle SE, Ng C, Patel R, Aguilera JL, Johnson JR, Wong SQ, Lapierre LR.
Lipid droplets modulate proteostasis, SQST-1/SQSTM1 dynamics, and lifespan in C. elegans.
iScience 2023 26(10) 107960 
[ PubMed ID = 37810233 ] [ RRC reference ]

Huang X, Wang C, Zhang T, Li R, Chen L, Leung KL, Lakso M, Zhou Q, Zhang H, Wong G.
PIWI-interacting RNA expression regulates pathogenesis in a Caenorhabditis elegans model of Lewy body disease.
Nat Commun 2023 14(1) 6137 
[ PubMed ID = 37783675 ] [ RRC reference ]

Possik E, Klein LL, Sanjab P, Zhu R, Côté L, Bai Y, Zhang D, Sun H, Al-Mass A, Oppong A, Ahmad R, Parker A, Madiraju SRM, Al-Mulla F, Prentki M.
Glycerol 3-phosphate phosphatase/PGPH-2 counters metabolic stress and promotes healthy aging via a glycogen sensing-AMPK-HLH-30-autophagy axis in C. elegans.
Nat Commun 2023 14(1) 5214 
[ PubMed ID = 37626039 ] [ RRC reference ]

Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716 
[ PubMed ID = 37349299 ] [ RRC reference ]

Lazaro-Pena MI, Cornwell AB, Diaz-Balzac CA, Das R, Ward ZC, Macoretta N, Thakar J, Samuelson AV.
Homeodomain-interacting protein kinase maintains neuronal homeostasis during normal Caenorhabditis elegans aging and systemically regulates longevity from serotonergic and GABAergic neurons.
Elife 2023 12  
[ PubMed ID = 37338980 ] [ RRC reference ]