分離済み変異体

tm1978

Allele Name

tm1978

Allele Type

通常株

Sequence Name

W02C12.3

Gene Name

hlh-30

Worm Base

Allele Name

tm1978

Gene Name

hlh-30

Sequence

W02C12.3

Phenotype

homozygous viable

Mutation site

11784/11785-12494/12495 (710 bp deletion)

Chromosome

Putative gene structure

complement(join(10396..10566, 11129..11205, 11271..11421, 11471..11759, 12196..12271, 12330..12474, 12670..12798, 12894..12968, 13124..13219, 13331..13618))

Map position

-1.01

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CACTATAATCTGGCGGGCTA,IntFwd:CTAGCCGATCCGACCGAGAA,ExtRev:TGGCCCGTACTCTGTTAGAA,IntRev:CCAGTGACGGCAGCGACAAA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023
[ PubMed ID = 38045350 ] [ RRC reference ]

Huang X, Wang C, Zhang T, Li R, Chen L, Leung KL, Lakso M, Zhou Q, Zhang H, Wong G.
PIWI-interacting RNA expression regulates pathogenesis in a Caenorhabditis elegans model of Lewy body disease.
Nat Commun 2023 14(1) 6137
[ PubMed ID = 37783675 ] [ RRC reference ]

Taylor SKB, Hartman JH, Gupta BP.
Neurotrophic factor MANF regulates autophagy and lysosome function to promote proteostasis in C. elegans.
bioRxiv 2024
[ PubMed ID = 38260421 ] [ RRC reference ]

Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12
[ PubMed ID = 38446031 ] [ RRC reference ]

Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716
[ PubMed ID = 37349299 ] [ RRC reference ]

Kumar AV, Mills J, Parker WM, Leitão JA, Rodriguez DI, Daigle SE, Ng C, Patel R, Aguilera JL, Johnson JR, Wong SQ, Lapierre LR.
Lipid droplets modulate proteostasis, SQST-1/SQSTM1 dynamics, and lifespan in C. elegans.
iScience 2023 26(10) 107960
[ PubMed ID = 37810233 ] [ RRC reference ]

Lazaro-Pena MI, Cornwell AB, Diaz-Balzac CA, Das R, Ward ZC, Macoretta N, Thakar J, Samuelson AV.
Homeodomain-interacting protein kinase maintains neuronal homeostasis during normal Caenorhabditis elegans aging and systemically regulates longevity from serotonergic and GABAergic neurons.
Elife 2023 12
[ PubMed ID = 37338980 ] [ RRC reference ]

Possik E, Klein LL, Sanjab P, Zhu R, Côté L, Bai Y, Zhang D, Sun H, Al-Mass A, Oppong A, Ahmad R, Parker A, Madiraju SRM, Al-Mulla F, Prentki M.
Glycerol 3-phosphate phosphatase/PGPH-2 counters metabolic stress and promotes healthy aging via a glycogen sensing-AMPK-HLH-30-autophagy axis in C. elegans.
Nat Commun 2023 14(1) 5214
[ PubMed ID = 37626039 ] [ RRC reference ]

Gonzalez X, Irazoqui JE.
Distinct members of the C. elegans CeMbio reference microbiota exert cryptic virulence and infection protection.
bioRxiv 2023
[ PubMed ID = 37961109 ] [ RRC reference ]

Ham S, Kim SS, Park S, Kwon HC, Ha SG, Bae Y, Lee GY, Lee SV.
Combinatorial transcriptomic and genetic dissection of insulin/IGF-1 signaling-regulated longevity in Caenorhabditis elegans.
Aging Cell 2024 e14151
[ PubMed ID = 38529797 ] [ RRC reference ]

Metcalf MG, Monshietehadi S, Sahay A, Durieux J, Frakes AE, Velichkovska M, Mena C, Farinas A, Sanchez M, Dillin A.
Cell non-autonomous control of autophagy and metabolism by glial cells.
iScience 2024 27(4) 109354
[ PubMed ID = 38500817 ] [ RRC reference ]

Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H.
A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway.
Front Immunol 2023 14 1249436
[ PubMed ID = 37928537 ] [ RRC reference ]

Zheng T, Luo Q, Han C, Zhou J, Gong J, Chun L, Xu XZS, Liu J.
Cytoplasmic and mitochondrial aminoacyl-tRNA synthetases differentially regulate lifespan in Caenorhabditis elegans.
iScience 2022 25(11) 105266
[ PubMed ID = 36304099 ] [ RRC reference ]

Yang R, Kang Y, Duan J, Zou C, Wu Q.
The p38 MAPK/PMK-1 Pathway Is Required for Resistance to Nocardia farcinica Infection in Caenorhabditis elegance.
Pathogens 2022 11(10)
[ PubMed ID = 36297128 ] [ RRC reference ]

Wong SQ, Ryan CJ, Bonal DM, Mills J, Lapierre LR.
Neuronal HLH-30/TFEB modulates peripheral mitochondrial fragmentation to improve thermoresistance in Caenorhabditis elegans.
Aging Cell 2023 22(3) e13741
[ PubMed ID = 36419219 ] [ RRC reference ]

Webster AK, Chitrakar R, Taylor SM, Baugh LR.
Alternative somatic and germline gene-regulatory strategies during starvation-induced developmental arrest.
Cell Rep 2022 41(2) 111473
[ PubMed ID = 36223742 ] [ RRC reference ]

Palikaras K, Mari M, Ploumi C, Princz A, Filippidis G, Tavernarakis N.
Age-dependent nuclear lipid droplet deposition is a cellular hallmark of aging in Caenorhabditis elegans.
Aging Cell 2023 22(4) e13788
[ PubMed ID = 36718841 ] [ RRC reference ]

Ogawa T, Masumura K, Kohara Y, Kanai M, Soga T, Ohya Y, Blackwell TK, Mizunuma M.
S-adenosyl-L-homocysteine extends lifespan through methionine restriction effects.
Aging Cell 2022 21(5) e13604
[ PubMed ID = 35388610 ] [ RRC reference ]

Mohankumar A, Kalaiselvi D, Thiruppathi G, Muthusaravanan S, Vijayakumar S, Suresh R, Tawata S, Sundararaj P.
Santalol Isomers Inhibit Transthyretin Amyloidogenesis and Associated Pathologies in Caenorhabditis elegans.
Front Pharmacol 2022 13 924862
[ PubMed ID = 35784752 ] [ RRC reference ]

McDonagh A, Crew J, van der Linden AM.
Dietary vitamin B12 regulates chemosensory receptor gene expression via the MEF2 transcription factor in Caenorhabditis elegans.
G3 (Bethesda) 2022 12(6)
[ PubMed ID = 35512190 ] [ RRC reference ]