Mutants (Isolated)

tm1974

Allele Nametm1974
Sequence NameY24F12A.2
CGC Nameragc-1
Worm BaseAllele Name tm1974
CGC Name ragc-1
Sequence Y24F12A.2
Phenotypehomozygous viable
Mutation site627/638-1036/1037 (409 bp deletion)
ChromosomeIV
Putative gene structurejoin(complement(993..1099), complement(849..943), complement(325..770), complement(137..279), complement(Z73426.1:15881..16106))
Map position5.04
Balancer
Map position of balancer
Sequence of primersIntFwd:AACGAGGGCAAGATGCTTGT,ExtFwd:CCTATCGGAATTGCCTGGTT,IntRev:AGCCTTCTTGCGAGAGCTCA,ExtRev:TCTCCCGGGTGGAACATAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fukuyama M, Sakuma K, Park R, Kasuga H, Nagaya R, Atsumi Y, Shimomura Y, Takahashi S, Kajiho H, Rougvie A, Kontani K, Katada T.
C. elegans AMPKs promote survival and arrest germline development during nutrient stress.
Biol Open 2012 1(10) 929-36 
[ PubMed ID = 23213370 ] [ RRC reference ]

Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, Boyko A, Mazer T, Ang S, Khopkar R, Javaheri A, Kumar S, Jiang X, Ory D, Mani K, Matkovich SJ, Kornfeld K, Diwan A.
Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival.
PLoS Biol. 2019 17(5) e3000245 
[ PubMed ID = 31086360 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr. Biol. 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]