Mutants (Isolated)

tm1966

Allele Nametm1966
Sequence NameK08F11.5
CGC Namemiro-1
Worm BaseAllele Name tm1966
CGC Name miro-1
Sequence K08F11.5
Phenotypehomozygous viable. Dr. X. Wang: normal apoptosis.
Mutation site12993/12994-ACC-13401/13402 (408 bp deletion + 3 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(11508..11672, 11732..11864, 11918..12305, 12897..13044, 13095..13836, 13890..13986, 14039..14112, 14161..14291))
Map position0.7
Balancer
Map position of balancer
Sequence of primersExtRev:GCGATTGAACCACCGTGGCT,IntRev:TCCTCACGGAAACGCTCTGT,ExtFwd:CGGACTTTTACGTGCCGAAG,IntFwd:TCCATCCACTGCGACACGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shen Y, Ng LF, Low NP, Hagen T, Gruber J, Inoue T.
C. elegans miro-1 Mutation Reduces the Amount of Mitochondria and Extends Life Span.
PLoS ONE 2016 11(4) e0153233 
[ PubMed ID = 27064409 ] [ RRC reference ]

Sure GR, Chatterjee A, Mishra N, Sabharwal V, Devireddy S, Awasthi A, Mohan S, Koushika SP.
UNC-16/JIP3 and UNC-76/FEZ1 limit the density of mitochondria in C. elegans neurons by maintaining the balance of anterograde and retrograde mitochondrial transport.
Sci Rep 2018 8(1) 8938 
[ PubMed ID = 29895958 ] [ RRC reference ]

Xu S, Wang Z, Kim KW, Jin Y, Chisholm AD.
Targeted Mutagenesis of Duplicated Genes in Caenorhabditis elegans Using CRISPR-Cas9.
J Genet Genomics 2016 43(2) 103-6 
[ PubMed ID = 26924693 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050 
[ PubMed ID = 32103012 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet. 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]

Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y.
A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans.
Front Neurosci 2017 11 263 
[ PubMed ID = 28539870 ] [ RRC reference ]