Home > Mutants (Isolated) > tm1966

Mutants (Isolated)

Allele Name		tm1966
Balance		Not Required
OutCross		Not Accepted
Sequence Name		K08F11.5
Gene Name		miro-1
Worm Base	Allele Name	tm1966
	Gene Name	miro-1
	Sequence	K08F11.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. X. Wang: normal apoptosis.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		12993/12994-ACC-13401/13402 (408 bp deletion + 3 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(11508..11672, 11732..11864, 11918..12305, 12897..13044, 13095..13836, 13890..13986, 14039..14112, 14161..14291))
Map position		0.7
Balancer
Map position of balancer
Sequence of primers		ExtRev:GCGATTGAACCACCGTGGCT,IntRev:TCCTCACGGAAACGCTCTGT,ExtFwd:CGGACTTTTACGTGCCGAAG,IntFwd:TCCATCCACTGCGACACGTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Hegde S, Modi S, Deihl EW, Glomb OV, Yogev S, Hoerndli FJ, Koushika SP. Axonal mitochondria regulate gentle touch response through control of axonal actin dynamics. bioRxiv 2024    [ PubMed ID = 39185223 ] [ RRC reference ] Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69  [ PubMed ID = 38164610 ] [ RRC reference ] Ren X, Zhou H, Sun Y, Fu H, Ran Y, Yang B, Yang F, Bjorklund M, Xu S. MIRO-1 interacts with VDAC-1 to regulate mitochondrial membrane potential in Caenorhabditis elegans. EMBO Rep 2023 24(8) e56297  [ PubMed ID = 37306041 ] [ RRC reference ] Ding C, Wu Y, Dabas H, Hammarlund M. Activation of the CaMKII-Sarm1-ASK1-p38 MAP kinase pathway protects against axon degeneration caused by loss of mitochondria. Elife 2022 11   [ PubMed ID = 35285800 ] [ RRC reference ] Chen YC, Huang HR, Hsu CH, Ou CY. CRMP/UNC-33 organizes microtubule bundles for KIF5-mediated mitochondrial distribution to axon. PLoS Genet 2021 17(2) e1009360  [ PubMed ID = 33571181 ] [ RRC reference ] Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S. Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling. Nat Commun 2020 11(1) 1050  [ PubMed ID = 32103012 ] [ RRC reference ] Raiders SA, Eastwood MD, Bacher M, Priess JR. Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis. PLoS Genet 2018 14(7) e1007417  [ PubMed ID = 30024879 ] [ RRC reference ] Sure GR, Chatterjee A, Mishra N, Sabharwal V, Devireddy S, Awasthi A, Mohan S, Koushika SP. UNC-16/JIP3 and UNC-76/FEZ1 limit the density of mitochondria in C. elegans neurons by maintaining the balance of anterograde and retrograde mitochondrial transport. Sci Rep 2018 8(1) 8938  [ PubMed ID = 29895958 ] [ RRC reference ] Knowlton WM, Hubert T, Wu Z, Chisholm AD, Jin Y. A Select Subset of Electron Transport Chain Genes Associated with Optic Atrophy Link Mitochondria to Axon Regeneration in Caenorhabditis elegans. Front Neurosci 2017 11 263  [ PubMed ID = 28539870 ] [ RRC reference ] Xu S, Wang Z, Kim KW, Jin Y, Chisholm AD. Targeted Mutagenesis of Duplicated Genes in Caenorhabditis elegans Using CRISPR-Cas9. J Genet Genomics 2016 43(2) 103-6  [ PubMed ID = 26924693 ] [ RRC reference ] Shen Y, Ng LF, Low NP, Hagen T, Gruber J, Inoue T. C. elegans miro-1 Mutation Reduces the Amount of Mitochondria and Extends Life Span. PLoS One 2016 11(4) e0153233  [ PubMed ID = 27064409 ] [ RRC reference ]