Mutants (Isolated)

tm1954

Allele Nametm1954
Sequence NameF54F3.3
CGC Namelipl-1
Worm BaseAllele Name tm1954
CGC Name lipl-1
Sequence F54F3.3
Phenotypehomozygous viable
Mutation site12187/12188-CCCCTCCC-13220/13221 (1033 bp deletion + 8 bp insertion)
ChromosomeV
Putative gene structurejoin(12340..12432, 12542..12641, 12803..13431, 13479..13754, 13808..13927)
Map position4.73
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTTTGGTACGGTTGCAGAG,IntFwd:ACTACGACTCCTTTCCGTGA,ExtRev:GATATGCTGGCAGGATAAAG,IntRev:CCCCAGATGAAATCGAGATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
O'Rourke D, Baban D, Demidova M, Mott R, Hodgkin J.
Genomic clusters, putative pathogen recognition molecules, and antimicrobial genes are induced by infection of C. elegans with M. nematophilum.
Genome Res. 2006 16(8) 1005-16 
[ PubMed ID = 16809667 ] [ RRC reference ]

O'Rourke EJ, Ruvkun G.
MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability.
Nat. Cell Biol. 2013 15(6) 668-76 
[ PubMed ID = 23604316 ] [ RRC reference ]

Palikaras K, Mari M, Petanidou B, Pasparaki A, Filippidis G, Tavernarakis N.
Ectopic fat deposition contributes to age-associated pathology in Caenorhabditis elegans.
J. Lipid Res. 2017 58(1) 72-80 
[ PubMed ID = 27884963 ] [ RRC reference ]