Mutants (Isolated)

tm1946

Allele Nametm1946
Sequence NameY39G10AR.22
CGC NameY39G10AR.22
Worm BaseAllele Name tm1946
CGC Name Y39G10AR.22
Sequence Y39G10AR.22
Phenotypehomozygous viable. Dr. P. Sengupta: normal dye filling.
Mutation site46488/46489-48204/48205 (1716 bp deletion)
ChromosomeI
Putative gene structurejoin(46261..46438, 47206..47663, 48193..48426)
Map position-9.24
Balancer
Map position of balancer
Sequence of primersExtFwd:TCATGACGTACGTCCGCACT,IntFwd:CCGCACTGATGCTCATCGAA,ExtRev:GACCATGTGAGCACAGTCGA,IntRev:CCTCGATCATAAATCCGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhou Y, Loeza-Cabrera M, Liu Z, Aleman-Meza B, Nguyen JK, Jung SK, Choi Y, Shou Q, Butcher RA, Zhong W.
Potential Nematode Alarm Pheromone Induces Acute Avoidance in Caenorhabditis elegans.
Genetics 2017 206(3) 1469-1478 
[ PubMed ID = 28495959 ] [ RRC reference ]

Park JY, Joo HJ, Park S, Paik YK.
Ascaroside Pheromones: Chemical Biology and Pleiotropic Neuronal Functions.
Int J Mol Sci 2019 20(16)  
[ PubMed ID = 31405082 ] [ RRC reference ]

Yamada K, Hirotsu T, Matsuki M, Butcher RA, Tomioka M, Ishihara T, Clardy J, Kunitomo H, Iino Y.
Olfactory plasticity is regulated by pheromonal signaling in Caenorhabditis elegans.
Science 2010 329(5999) 1647-50 
[ PubMed ID = 20929849 ] [ RRC reference ]

Park J, Choi W, Dar AR, Butcher RA, Kim K.
Neuropeptide Signaling Regulates Pheromone-Mediated Gene Expression of a Chemoreceptor Gene in C. elegans.
Mol Cells 2019 42(1) 28-35 
[ PubMed ID = 30453729 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705 
[ PubMed ID = 27172180 ] [ RRC reference ]

Neal SJ, Park J, DiTirro D, Yoon J, Shibuya M, Choi W, Schroeder FC, Butcher RA, Kim K, Sengupta P.
A Forward Genetic Screen for Molecules Involved in Pheromone-Induced Dauer Formation in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1475-87 
[ PubMed ID = 26976437 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Seidel HS, Rockman MV, Kruglyak L.
Widespread genetic incompatibility in C. elegans maintained by balancing selection.
Science 2008 319(5863) 589-94 
[ PubMed ID = 18187622 ] [ RRC reference ]

Kim K, Sato K, Shibuya M, Zeiger DM, Butcher RA, Ragains JR, Clardy J, Touhara K, Sengupta P.
Two chemoreceptors mediate developmental effects of dauer pheromone in C. elegans.
Science 2009 326(5955) 994-8 
[ PubMed ID = 19797623 ] [ RRC reference ]