分離済み変異体

tm1946

Allele Name

tm1946

Allele Type

通常株

Sequence Name

Y39G10AR.22

Gene Name

Y39G10AR.22

Worm Base

Allele Name

tm1946

Gene Name

Y39G10AR.22

Sequence

Y39G10AR.22

Phenotype

homozygous viable. Dr. P. Sengupta: normal dye filling.

Mutation site

46488/46489-48204/48205 (1716 bp deletion)

Chromosome

Putative gene structure

join(46261..46438, 47206..47663, 48193..48426)

Map position

-9.24

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TCATGACGTACGTCCGCACT,IntFwd:CCGCACTGATGCTCATCGAA,ExtRev:GACCATGTGAGCACAGTCGA,IntRev:CCTCGATCATAAATCCGGCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Peng JY, Liu X, Zeng XT, Hao Y, Zhang JH, Li Q, Tong XJ.
Early pheromone perception remodels neurodevelopment and accelerates neurodegeneration in adult C. elegans.
Cell Rep 2023 42(6) 112598
[ PubMed ID = 37289584 ] [ RRC reference ]

Park JY, Joo HJ, Park S, Paik YK.
Ascaroside Pheromones: Chemical Biology and Pleiotropic Neuronal Functions.
Int J Mol Sci 2019 20(16)
[ PubMed ID = 31405082 ] [ RRC reference ]

Park J, Choi W, Dar AR, Butcher RA, Kim K.
Neuropeptide Signaling Regulates Pheromone-Mediated Gene Expression of a Chemoreceptor Gene in C. elegans.
Mol Cells 2019 42(1) 28-35
[ PubMed ID = 30453729 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705
[ PubMed ID = 27172180 ] [ RRC reference ]

Neal SJ, Park J, DiTirro D, Yoon J, Shibuya M, Choi W, Schroeder FC, Butcher RA, Kim K, Sengupta P.
A Forward Genetic Screen for Molecules Involved in Pheromone-Induced Dauer Formation in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1475-87
[ PubMed ID = 26976437 ] [ RRC reference ]

Zhou Y, Loeza-Cabrera M, Liu Z, Aleman-Meza B, Nguyen JK, Jung SK, Choi Y, Shou Q, Butcher RA, Zhong W.
Potential Nematode Alarm Pheromone Induces Acute Avoidance in Caenorhabditis elegans.
Genetics 2017 206(3) 1469-1478
[ PubMed ID = 28495959 ] [ RRC reference ]

Yamada K, Hirotsu T, Matsuki M, Butcher RA, Tomioka M, Ishihara T, Clardy J, Kunitomo H, Iino Y.
Olfactory plasticity is regulated by pheromonal signaling in Caenorhabditis elegans.
Science 2010 329(5999) 1647-50
[ PubMed ID = 20929849 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84
[ PubMed ID = 24646679 ] [ RRC reference ]

Kim K, Sato K, Shibuya M, Zeiger DM, Butcher RA, Ragains JR, Clardy J, Touhara K, Sengupta P.
Two chemoreceptors mediate developmental effects of dauer pheromone in C. elegans.
Science 2009 326(5955) 994-8
[ PubMed ID = 19797623 ] [ RRC reference ]

Seidel HS, Rockman MV, Kruglyak L.
Widespread genetic incompatibility in C. elegans maintained by balancing selection.
Science 2008 319(5863) 589-94
[ PubMed ID = 18187622 ] [ RRC reference ]