Mutants (Isolated)

tm1944

Allele Nametm1944
Sequence NamePAR2.3
CGC Nameaak-1
Worm BaseAllele Name tm1944
CGC Name aak-1
Sequence PAR2.3
Phenotypehomozygous viable. Dr. L. Avery: mildly sensitive to long-term starvation (e.g. 15 days of starvation as L1). Dr. K. Ashrafi: normal Nile Red staining.
Mutation site5139/5140-5757/5758 (618 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(2399..2524, 2582..2670, 3146..3280, 3628..4180, 4408..4458, 4608..4816, 4865..5126, 5406..5731, 6094..6211)
Map position-0.06
Balancer
Map position of balancer
Sequence of primersExtRev:ACTCAATCGCGTGACCTCCT,ExtFwd:CGAACCTCTGCAACACTCTG,IntFwd:TCGATACGGAACCAACTGTG,IntRev:GTGACCTCCTCAGACCCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee H, Cho JS, Lambacher N, Lee J, Lee SJ, Lee TH, Gartner A, Koo HS.
The Caenorhabditis elegans AMP-activated protein kinase AAK-2 is phosphorylated by LKB1 and is required for resistance to oxidative stress and for normal motility and foraging behavior.
J. Biol. Chem. 2008 283(22) 14988-93 
[ PubMed ID = 18408008 ] [ RRC reference ]

Narbonne P, Maddox PS, Labbé JC.
DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation.
PLoS Genet. 2017 13(4) e1006738 
[ PubMed ID = 28410423 ] [ RRC reference ]

Lee J, Yue Y, Park Y, Lee SH.
3,3'-Diindolylmethane Suppresses Adipogenesis Using AMPKα-Dependent Mechanism in 3T3-L1 Adipocytes and Caenorhabditis elegans.
J Med Food 2017 20(7) 646-652 
[ PubMed ID = 28459610 ] [ RRC reference ]

Wang Y, Xie C, Diao Z, Liang B.
Calcineurin Antagonizes AMPK to Regulate Lipolysis in Caenorhabditis elegans.
Molecules 2017 22(7)  
[ PubMed ID = 28672869 ] [ RRC reference ]

Webster CM, Pino EC, Carr CE, Wu L, Zhou B, Cedillo L, Kacergis MC, Curran SP, Soukas AA.
Genome-wide RNAi Screen for Fat Regulatory Genes in C. elegans Identifies a Proteostasis-AMPK Axis Critical for Starvation Survival.
Cell Rep 2017 20(3) 627-640 
[ PubMed ID = 28723566 ] [ RRC reference ]

Martin E, Bonnamour G, Jenna S.
AMPK and autophagy control embryonic elongation as part of a RhoA-like morphogenic program in nematode.
Small GTPases 2017  1-8 
[ PubMed ID = 29172954 ] [ RRC reference ]

Seidel HS, Kimble J.
Cell-cycle quiescence maintains Caenorhabditis elegans germline stem cells independent of GLP-1/Notch.
Elife 2015 4  
[ PubMed ID = 26551561 ] [ RRC reference ]

Xie M, Roy R.
The Causative Gene in Chanarian Dorfman Syndrome Regulates Lipid Droplet Homeostasis in C. elegans.
PLoS Genet. 2015 11(6) e1005284 
[ PubMed ID = 26083785 ] [ RRC reference ]

Lee JH, Kong J, Jang JY, Han JS, Ji Y, Lee J, Kim JB.
Lipid droplet protein LID-1 mediates ATGL-1-dependent lipolysis during fasting in Caenorhabditis elegans.
Mol. Cell. Biol. 2014 34(22) 4165-76 
[ PubMed ID = 25202121 ] [ RRC reference ]

Possik E, Jalali Z, Nouët Y, Yan M, Gingras MC, Schmeisser K, Panaite L, Dupuy F, Kharitidi D, Chotard L, Jones RG, Hall DH, Pause A.
Folliculin regulates ampk-dependent autophagy and metabolic stress survival.
PLoS Genet. 2014 10(4) e1004273 
[ PubMed ID = 24763318 ] [ RRC reference ]

Lemieux GA, Liu J, Mayer N, Bainton RJ, Ashrafi K, Werb Z.
A whole-organism screen identifies new regulators of fat storage.
Nat. Chem. Biol. 2011 7(4) 206-13 
[ PubMed ID = 21390037 ] [ RRC reference ]

Schiavi A, Torgovnick A, Kell A, Megalou E, Castelein N, Guccini I, Marzocchella L, Gelino S, Hansen M, Malisan F, Condò I, Bei R, Rea SL, Braeckman BP, Tavernarakis N, Testi R, Ventura N.
Autophagy induction extends lifespan and reduces lipid content in response to frataxin silencing in C. elegans.
Exp. Gerontol. 2013 48(2) 191-201 
[ PubMed ID = 23247094 ] [ RRC reference ]

Xie M, Roy R.
Increased levels of hydrogen peroxide induce a HIF-1-dependent modification of lipid metabolism in AMPK compromised C. elegans dauer larvae.
Cell Metab. 2012 16(3) 322-35 
[ PubMed ID = 22921415 ] [ RRC reference ]

Mair W, Morantte I, Rodrigues AP, Manning G, Montminy M, Shaw RJ, Dillin A.
Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB.
Nature 2011 470(7334) 404-8 
[ PubMed ID = 21331044 ] [ RRC reference ]

Mair W, Panowski SH, Shaw RJ, Dillin A.
Optimizing dietary restriction for genetic epistasis analysis and gene discovery in C. elegans.
PLoS ONE 2009 4(2) e4535 
[ PubMed ID = 19229346 ] [ RRC reference ]

Kadekar P, Chaouni R, Clark E, Kazanets A, Roy R.
Genome-wide surveys reveal polarity and cytoskeletal regulators mediate LKB1-associated germline stem cell quiescence.
BMC Genomics 2018 19(1) 462 
[ PubMed ID = 29907081 ] [ RRC reference ]

Possik E, Ajisebutu A, Manteghi S, Gingras MC, Vijayaraghavan T, Flamand M, Coull B, Schmeisser K, Duchaine T, van Steensel M, Hall DH, Pause A.
FLCN and AMPK Confer Resistance to Hyperosmotic Stress via Remodeling of Glycogen Stores.
PLoS Genet. 2015 11(10) e1005520 
[ PubMed ID = 26439621 ] [ RRC reference ]

Cunningham KA, Bouagnon AD, Barros AG, Lin L, Malard L, Romano-Silva MA, Ashrafi K.
Loss of a neural AMP-activated kinase mimics the effects of elevated serotonin on fat, movement, and hormonal secretions.
PLoS Genet. 2014 10(6) e1004394 
[ PubMed ID = 24921650 ] [ RRC reference ]

Fukuyama M, Sakuma K, Park R, Kasuga H, Nagaya R, Atsumi Y, Shimomura Y, Takahashi S, Kajiho H, Rougvie A, Kontani K, Katada T.
C. elegans AMPKs promote survival and arrest germline development during nutrient stress.
Biol Open 2012 1(10) 929-36 
[ PubMed ID = 23213370 ] [ RRC reference ]

Narbonne P, Hyenne V, Li S, Labbé JC, Roy R.
Differential requirements for STRAD in LKB1-dependent functions in C. elegans.
Development 2010 137(4) 661-70 
[ PubMed ID = 20110331 ] [ RRC reference ]