分離済み変異体

tm1944

Allele Name

tm1944

Allele Type

通常株

Sequence Name

PAR2.3

Gene Name

aak-1

Worm Base

Allele Name

tm1944

Gene Name

aak-1

Sequence

PAR2.3

Phenotype

homozygous viable. Dr. L. Avery: mildly sensitive to long-term starvation (e.g. 15 days of starvation as L1). Dr. K. Ashrafi: normal Nile Red staining.

Mutation site

5139/5140-5757/5758 (618 bp deletion)

Chromosome

III

Putative gene structure

complement(join(2399..2524, 2582..2670, 3146..3280, 3628..4180, 4408..4458, 4608..4816, 4865..5126, 5406..5731, 6094..6211)

Map position

-0.06

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CGAACCTCTGCAACACTCTG,ExtRev:ACTCAATCGCGTGACCTCCT,IntFwd:TCGATACGGAACCAACTGTG,IntRev:GTGACCTCCTCAGACCCTAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Sun B, Sherrin M, Roy R.
Unscheduled epigenetic modifications cause genome instability and sterility through aberrant R-loops following starvation.
Nucleic Acids Res 2023 51(1) 84-98
[ PubMed ID = 36504323 ] [ RRC reference ]

McLachlan IG, Kramer TS, Dua M, DiLoreto EM, Gomes MA, Dag U, Srinivasan J, Flavell SW.
Diverse states and stimuli tune olfactory receptor expression levels to modulate food-seeking behavior.
Elife 2022 11
[ PubMed ID = 36044259 ] [ RRC reference ]

Kawano T, Kashiwagi M, Kanuka M, Chen CK, Yasugaki S, Hatori S, Miyazaki S, Tanaka K, Fujita H, Nakajima T, Yanagisawa M, Nakagawa Y, Hayashi Y.
ER proteostasis regulators cell-non-autonomously control sleep.
Cell Rep 2023 42(3) 112267
[ PubMed ID = 36924492 ] [ RRC reference ]

Ju S, Chen H, Wang S, Lin J, Ma Y, Aroian RV, Peng D, Sun M.
C. elegans monitor energy status via the AMPK pathway to trigger innate immune responses against bacterial pathogens.
Commun Biol 2022 5(1) 643
[ PubMed ID = 35773333 ] [ RRC reference ]

Houri-Zeevi L, Teichman G, Gingold H, Rechavi O.
Stress resets ancestral heritable small RNA responses.
Elife 2021 10
[ PubMed ID = 33729152 ] [ RRC reference ]

Qu Z, Ji S, Zheng S.
BRAF Controls the Effects of Metformin on Neuroblast Cell Divisions in C. elegans.
Int J Mol Sci 2020 22(1)
[ PubMed ID = 33375360 ] [ RRC reference ]

Kadekar P, Roy R.
AMPK regulates germline stem cell quiescence and integrity through an endogenous small RNA pathway.
PLoS Biol 2019 17(6) e3000309
[ PubMed ID = 31166944 ] [ RRC reference ]

Kadekar P, Chaouni R, Clark E, Kazanets A, Roy R.
Genome-wide surveys reveal polarity and cytoskeletal regulators mediate LKB1-associated germline stem cell quiescence.
BMC Genomics 2018 19(1) 462
[ PubMed ID = 29907081 ] [ RRC reference ]

Colella E, Li S, Roy R.
Developmental and Cell Cycle Quiescence Is Mediated by the Nuclear Hormone Receptor Coregulator DIN-1S in the Caenorhabditis elegans Dauer Larva.
Genetics 2016 203(4) 1763-76
[ PubMed ID = 27260305 ] [ RRC reference ]

Demoinet E, Li S, Roy R.
AMPK blocks starvation-inducible transgenerational defects in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(13) E2689-E2698
[ PubMed ID = 28289190 ] [ RRC reference ]

Alicea B.
Evolution in eggs and phases: experimental evolution of fecundity and reproductive timing in Caenorhabditis elegans.
R Soc Open Sci 2016 3(11) 160496
[ PubMed ID = 28018635 ] [ RRC reference ]

Wu L, Zhou B, Oshiro-Rapley N, Li M, Paulo JA, Webster CM, Mou F, Kacergis MC, Talkowski ME, Carr CE, Gygi SP, Zheng B, Soukas AA.
An Ancient, Unified Mechanism for Metformin Growth Inhibition in C. elegans and Cancer.
Cell 2016 167(7) 1705-1718.e13
[ PubMed ID = 27984722 ] [ RRC reference ]

Ishii T, Funato Y, Hashizume O, Yamazaki D, Hirata Y, Nishiwaki K, Kono N, Arai H, Miki H.
Mg2+ Extrusion from Intestinal Epithelia by CNNM Proteins Is Essential for Gonadogenesis via AMPK-TORC1 Signaling in Caenorhabditis elegans.
PLoS Genet 2016 12(8) e1006276
[ PubMed ID = 27564576 ] [ RRC reference ]

Martin E, Bonnamour G, Jenna S.
AMPK and autophagy control embryonic elongation as part of a RhoA-like morphogenic program in nematode.
Small GTPases 2020 11(3) 186-193
[ PubMed ID = 29172954 ] [ RRC reference ]

Webster CM, Pino EC, Carr CE, Wu L, Zhou B, Cedillo L, Kacergis MC, Curran SP, Soukas AA.
Genome-wide RNAi Screen for Fat Regulatory Genes in C. elegans Identifies a Proteostasis-AMPK Axis Critical for Starvation Survival.
Cell Rep 2017 20(3) 627-640
[ PubMed ID = 28723566 ] [ RRC reference ]

Wang Y, Xie C, Diao Z, Liang B.
Calcineurin Antagonizes AMPK to Regulate Lipolysis in Caenorhabditis elegans.
Molecules 2017 22(7)
[ PubMed ID = 28672869 ] [ RRC reference ]

Lee J, Yue Y, Park Y, Lee SH.
3,3'-Diindolylmethane Suppresses Adipogenesis Using AMPKα-Dependent Mechanism in 3T3-L1 Adipocytes and Caenorhabditis elegans.
J Med Food 2017 20(7) 646-652
[ PubMed ID = 28459610 ] [ RRC reference ]

Narbonne P, Maddox PS, Labbé JC.
DAF-18/PTEN signals through AAK-1/AMPK to inhibit MPK-1/MAPK in feedback control of germline stem cell proliferation.
PLoS Genet 2017 13(4) e1006738
[ PubMed ID = 28410423 ] [ RRC reference ]

Narbonne P, Hyenne V, Li S, Labbé JC, Roy R.
Differential requirements for STRAD in LKB1-dependent functions in C. elegans.
Development 2010 137(4) 661-70
[ PubMed ID = 20110331 ] [ RRC reference ]

Mair W, Morantte I, Rodrigues AP, Manning G, Montminy M, Shaw RJ, Dillin A.
Lifespan extension induced by AMPK and calcineurin is mediated by CRTC-1 and CREB.
Nature 2011 470(7334) 404-8
[ PubMed ID = 21331044 ] [ RRC reference ]