Mutants (Isolated)

tm1943

Allele Nametm1943
Sequence NameF10G8.5
CGC Namencs-2
Worm BaseAllele Name tm1943
CGC Name ncs-2
Sequence F10G8.5
Phenotypehomozygous viable.
Mutation site15881/15882-16882/16883 (1001 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(15649..15837, 15942..16214, 16285..16395))
Map position4.56
Balancer
Map position of balancer
Sequence of primersExtFwd:ACTCTAATCCGTCGTCTAGT,IntFwd:TGAGTCTGTGGTTAGACGGA,ExtRev:TACTTGCTCGTCGAGCAGAC,IntRev:GAGGTGGGTACAGGTCGGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhou K, Cherra SJ 3rd, Goncharov A, Jin Y.
Asynchronous Cholinergic Drive Correlates with Excitation-Inhibition Imbalance via a Neuronal Ca2+ Sensor Protein.
Cell Rep 2017 19(6) 1117-1129 
[ PubMed ID = 28494862 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]