Mutants (Isolated)

tm1943

Allele Nametm1943
Allele TypeNormal
Sequence NameF10G8.5
Gene Namencs-2
Worm BaseAllele Name tm1943
Gene Name ncs-2
Sequence F10G8.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15881/15882-16882/16883 (1001 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(15649..15837, 15942..16214, 16285..16395))
Map position4.56
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:ACTCTAATCCGTCGTCTAGT,IntFwd:TGAGTCTGTGGTTAGACGGA,ExtRev:TACTTGCTCGTCGAGCAGAC,IntRev:GAGGTGGGTACAGGTCGGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hill TJ, Sengupta P.
Feedforward and feedback mechanisms cooperatively regulate rapid experience-dependent response adaptation in a single thermosensory neuron type.
bioRxiv 2023   
[ PubMed ID = 38168209 ] [ RRC reference ]

Blazie SM, Takayanagi-Kiya S, McCulloch KA, Jin Y.
Eukaryotic initiation factor EIF-3.G augments mRNA translation efficiency to regulate neuronal activity.
Elife 2021 10  
[ PubMed ID = 34323215 ] [ RRC reference ]

Zhou K, Cherra SJ 3rd, Goncharov A, Jin Y.
Asynchronous Cholinergic Drive Correlates with Excitation-Inhibition Imbalance via a Neuronal Ca2+ Sensor Protein.
Cell Rep 2017 19(6) 1117-1129 
[ PubMed ID = 28494862 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]