Mutants (Isolated)

tm1931

Allele Nametm1931
Sequence NameB0213.4
CGC Namenlp-29
Worm BaseAllele Name tm1931
CGC Name nlp-29
Sequence B0213.4
Phenotypehomozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C.
Mutation site32394/32395-AAAA-32888/32889 (494 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurejoin(32374..32464, 32534..32664)
Map position-7.34
Balancer
Map position of balancer
Sequence of primersExtRev:GGCTGCTGACTCCTGACAGT,IntRev:GACCAACGTCCTTCACGGGA,ExtFwd:ATGCTGCATGTGAAATCGCA,IntFwd:GGTCAGAAATGTTGCCCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pujol N, Zugasti O, Wong D, Couillault C, Kurz CL, Schulenburg H, Ewbank JJ.
Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides.
PLoS Pathog. 2008 4(7) e1000105 
[ PubMed ID = 18636113 ] [ RRC reference ]

E L, Zhou T, Koh S, Chuang M, Sharma R, Pujol N, Chisholm AD, Eroglu C, Matsunami H, Yan D.
An Antimicrobial Peptide and Its Neuronal Receptor Regulate Dendrite Degeneration in Aging and Infection.
Neuron 2018 97(1) 125-138.e5 
[ PubMed ID = 29301098 ] [ RRC reference ]