| Allele Name | tm1931 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | B0213.4 |
| Gene Name | nlp-29 |
| Worm Base | Allele Name |
tm1931
|
| Gene Name |
nlp-29
|
| Sequence |
B0213.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 32394/32395-AAAA-32888/32889 (494 bp deletion + 4 bp insertion) |
| Chromosome | V |
| Putative gene structure | join(32374..32464, 32534..32664) |
| Map position | -7.34 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GGCTGCTGACTCCTGACAGT,IntRev:GACCAACGTCCTTCACGGGA,ExtFwd:ATGCTGCATGTGAAATCGCA,IntFwd:GGTCAGAAATGTTGCCCATA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
E L, Zhou T, Koh S, Chuang M, Sharma R, Pujol N, Chisholm AD, Eroglu C, Matsunami H, Yan D. An Antimicrobial Peptide and Its Neuronal Receptor Regulate Dendrite Degeneration in Aging and Infection. Neuron 2018 97(1) 125-138.e5
[ PubMed ID = 29301098 ]
[ RRC reference ]
|
Pujol N, Zugasti O, Wong D, Couillault C, Kurz CL, Schulenburg H, Ewbank JJ. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog 2008 4(7) e1000105
[ PubMed ID = 18636113 ]
[ RRC reference ]
|
|