分離済み変異体

tm1907

Allele Nametm1907
Allele Type通常株
Sequence NameZK1251.2
Gene Nameins-7
Worm BaseAllele Name tm1907
Gene Name ins-7
Sequence ZK1251.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. Dr. S. Tuck: does not affect rsks-1 gene. Dr. M. Driscoll: normal dauer formation. Dr. P.W. Sternberg: normal locomotion.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10727/10728-11212/11213 (485 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(10833..10912, 10954..11191))
Map position4.35
Balancer
Map position of balancer
Sequence of primersIntRev:GTCTGCAATCGCGGCTAATG,ExtRev:CCAGAGAATCAGCCGCTCGA,IntFwd:CGAGATCAGTTTGCGTAGCT,ExtFwd:CATAGCGCGAGATCAGTTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Earley BJ, Cubillas C, Warnhoff K, Ahmad R, Alcantar A, Lyon MD, Schneider DL, Kornfeld K.
Cadmium hijacks the high zinc response by binding and activating the HIZR-1 nuclear receptor.
Proc Natl Acad Sci U S A 2021 118(42)  
[ PubMed ID = 34649987 ] [ RRC reference ]

Yan J, Zhao N, Yang Z, Li Y, Bai H, Zou W, Zhang K, Huang X.
A trade-off switch of two immunological memories in Caenorhabditis elegans reinfected by bacterial pathogens.
J Biol Chem 2020 295(50) 17323-17336 
[ PubMed ID = 33051209 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J 2018 37(15)  
[ PubMed ID = 29925517 ] [ RRC reference ]

Delaney CE, Chen AT, Graniel JV, Dumas KJ, Hu PJ.
A histone H4 lysine 20 methyltransferase couples environmental cues to sensory neuron control of developmental plasticity.
Development 2017 144(7) 1273-1282 
[ PubMed ID = 28209779 ] [ RRC reference ]

Kawli T, Wu C, Tan MW.
Systemic and cell intrinsic roles of Gqalpha signaling in the regulation of innate immunity, oxidative stress, and longevity in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2010 107(31) 13788-93 
[ PubMed ID = 20647387 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85 
[ PubMed ID = 23395381 ] [ RRC reference ]

Ritter AD, Shen Y, Fuxman Bass J, Jeyaraj S, Deplancke B, Mukhopadhyay A, Xu J, Driscoll M, Tissenbaum HA, Walhout AJ.
Complex expression dynamics and robustness in C. elegans insulin networks.
Genome Res 2013 23(6) 954-65 
[ PubMed ID = 23539137 ] [ RRC reference ]

Hahm JH, Kim S, Paik YK.
GPA-9 is a novel regulator of innate immunity against Escherichia coli foods in adult Caenorhabditis elegans.
Aging Cell 2011 10(2) 208-19 
[ PubMed ID = 21108728 ] [ RRC reference ]

Sato K, Yoshiga T, Hasegawa K.
Activated and inactivated immune responses in Caenorhabditis elegans against Photorhabdus luminescens TT01.
Springerplus 2014 3 274 
[ PubMed ID = 25279274 ] [ RRC reference ]

Yoshina S, Mitani S.
Loss of C. elegans GON-1, an ADAMTS9 Homolog, Decreases Secretion Resulting in Altered Lifespan and Dauer Formation.
PLoS One 2015 10(7) e0133966 
[ PubMed ID = 26218657 ] [ RRC reference ]

Matsunaga Y, Gengyo-Ando K, Mitani S, Iwasaki T, Kawano T.
Physiological function, expression pattern, and transcriptional regulation of a Caenorhabditis elegans insulin-like peptide, INS-18.
Biochem Biophys Res Commun 2012 423(3) 478-83 
[ PubMed ID = 22683638 ] [ RRC reference ]

Matsunaga Y, Honda Y, Honda S, Iwasaki T, Qadota H, Benian GM, Kawano T.
Diapause is associated with a change in the polarity of secretion of insulin-like peptides.
Nat Commun 2016 7 10573 
[ PubMed ID = 26838180 ] [ RRC reference ]

Mitani S.
Nematode, an experimental animal in the national BioResource project.
Exp Anim 2009 58(4) 351-6 
[ PubMed ID = 19654432 ] [ RRC reference ]

Kawli T, Tan MW.
Neuroendocrine signals modulate the innate immunity of Caenorhabditis elegans through insulin signaling.
Nat Immunol 2008 9(12) 1415-24 
[ PubMed ID = 18854822 ] [ RRC reference ]

Evans EA, Kawli T, Tan MW.
Pseudomonas aeruginosa suppresses host immunity by activating the DAF-2 insulin-like signaling pathway in Caenorhabditis elegans.
PLoS Pathog 2008 4(10) e1000175 
[ PubMed ID = 18927620 ] [ RRC reference ]

Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2007 104(48) 19046-50 
[ PubMed ID = 18025456 ] [ RRC reference ]