Mutants (Isolated)

tm1905

Allele Nametm1905
Sequence NameY17G7B.2
CGC Nameash-2
Worm BaseAllele Name tm1905
CGC Name ash-2
Sequence Y17G7B.2
Phenotypelethal or sterile. Dr. H.C. Korswagen: lin-22-like multiple postdeirid phenotypes. Dr. O. Hobert: does not affect ASE development.
Mutation site11628/11629-12229/12230 (601 bp deletion)
ChromosomeII
Putative gene structurejoin(11683..11753, 11836..11928, 11980..12304, 13242..13462, 14218..14331, 15865..16127, 17187..17299, 18228..18428, 18624..18714, 19438..19658)
Map position5.54
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:TTCGACGGCGAGGCGATTGT,IntFwd:GTCGCGGTCGATAAGCACTC,ExtRev:CGTGGCTCACGGTTTTCCCT,IntRev:CTGCCTCGTGTAGTGGTCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zuryn S, Ahier A, Portoso M, White ER, Morin MC, Margueron R, Jarriault S.
Transdifferentiation. Sequential histone-modifying activities determine the robustness of transdifferentiation.
Science 2014 345(6198) 826-9 
[ PubMed ID = 25124442 ] [ RRC reference ]

Xiao Y, Bedet C, Robert VJ, Simonet T, Dunkelbarger S, Rakotomalala C, Soete G, Korswagen HC, Strome S, Palladino F.
Caenorhabditis elegans chromatin-associated proteins SET-2 and ASH-2 are differentially required for histone H3 Lys 4 methylation in embryos and adult germ cells.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(20) 8305-10 
[ PubMed ID = 21527717 ] [ RRC reference ]

Robert VJ, Mercier MG, Bedet C, Janczarski S, Merlet J, Garvis S, Ciosk R, Palladino F.
The SET-2/SET1 histone H3K4 methyltransferase maintains pluripotency in the Caenorhabditis elegans germline.
Cell Rep 2014 9(2) 443-50 
[ PubMed ID = 25310986 ] [ RRC reference ]

Wang S, Fisher K, Poulin GB.
Lineage specific trimethylation of H3 on lysine 4 during C. elegans early embryogenesis.
Dev. Biol. 2011 355(2) 227-38 
[ PubMed ID = 21549110 ] [ RRC reference ]

Poole RJ, Bashllari E, Cochella L, Flowers EB, Hobert O.
A Genome-Wide RNAi Screen for Factors Involved in Neuronal Specification in Caenorhabditis elegans.
PLoS Genet. 2011 7(6) e1002109 
[ PubMed ID = 21698137 ] [ RRC reference ]