Mutants (Isolated)

tm1880

Allele Nametm1880
Sequence NameD1009.4
CGC Namenlp-14
Worm BaseAllele Name tm1880
CGC Name nlp-14
Sequence D1009.4
Phenotypehomozygous viable
Mutation site17382/17383-GCATTTCCGACC-18043/18044 (661 bp deletion + 12 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(16809..17103, 17539..17673, 17723..17857, 18007..18064, 18409..18460))
Map position0.45
Balancer
Map position of balancer
Sequence of primersIntRev:ACGACTTACGCCTCCCATCT,ExtFwd:ACTAATGCTGCTTGAACCCT,ExtRev:CCCGCCTCCTAGATGCTCTT,IntFwd:GTTCCGGAACACTGAACGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Clark T, Hapiak V, Oakes M, Mills H, Komuniecki R.
Monoamines differentially modulate neuropeptide release from distinct sites within a single neuron pair.
PLoS One 2018 13(5) e0196954 
[ PubMed ID = 29723289 ] [ RRC reference ]

Sherlekar AL, Janssen A, Siehr MS, Koo PK, Caflisch L, Boggess M, Lints R.
The C. elegans male exercises directional control during mating through cholinergic regulation of sex-shared command interneurons.
PLoS One 2013 8(4) e60597 
[ PubMed ID = 23577128 ] [ RRC reference ]

Guillermin ML, Carrillo MA, Hallem EA.
A Single Set of Interneurons Drives Opposite Behaviors in C. elegans.
Curr Biol 2017 27(17) 2630-2639.e6 
[ PubMed ID = 28823678 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]