Mutants (Isolated)

tm1869

Allele Nametm1869
Sequence NameF27D9.8
CGC Namestn-2
Worm BaseAllele Name tm1869
CGC Name stn-2
Sequence F27D9.8
Phenotypehomozygous viable. Dr. Lihsia Chen: short with hyperactive head bending.
Mutation site28260/28261-29071/29072 (811 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(26625..26750, 26801..26914, 26963..27055, 27101..27265, 27311..27376, 27430..27555, 27979..28147, 28234..28382, 28437..28500, 28930..29026, 29548..29613, 29666..29729, 29775..29908, 30345..30417, 30562..30597))
Map position-1.41
Balancer
Map position of balancer
Sequence of primersExtRev:CCTTCTCTGTTGGATGGGTT,IntRev:GGGTTATATATGCCGTCCTA,ExtFwd:AGGCAAACGTTCGGGACTAA,IntFwd:ACGGTTCGGTAATATGCTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhou S, Chen L.
Neural integrity is maintained by dystrophin in C. elegans.
J. Cell Biol. 2011 192(2) 349-63 
[ PubMed ID = 21242290 ] [ RRC reference ]

Zhou S, Opperman K, Wang X, Chen L.
unc-44 Ankyrin and stn-2 gamma-syntrophin regulate sax-7 L1CAM function in maintaining neuronal positioning in Caenorhabditis elegans.
Genetics 2008 180(3) 1429-43 
[ PubMed ID = 18791240 ] [ RRC reference ]