Mutants (Isolated)

tm1860

Allele Nametm1860
Sequence NameR09A1.1
CGC Nameergo-1
Worm BaseAllele Name tm1860
CGC Name ergo-1
Sequence R09A1.1
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. R. Lu: PLoS Pathogens 5, e1000286 (2009).
Mutation site7750/7751-8908/8909 (1158 bp deletion)
ChromosomeV
Putative gene structurejoin(5337..6277, 7119..7303, 8644..9562, 10623..10897, 11603..11682, 12892..13754, 14495..14597)
Map position-19.85
Balancer
Map position of balancer
Sequence of primersExtRev:GAGCGGCTGCTCAGAAGACT,IntFwd:ACCCGAGCTTCCGGATGTGT,IntRev:TCTCGGTGGATCATGAGTAA,ExtFwd:AAGCGTACGAACCCGAGCTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Dennis S, Sheth U, Feldman JL, English KA, Priess JR.
C. elegans germ cells show temperature and age-dependent expression of Cer1, a Gypsy/Ty3-related retrotransposon.
PLoS Pathog. 2012 8(3) e1002591 
[ PubMed ID = 22479180 ] [ RRC reference ]

Massirer KB, Perez SG, Mondol V, Pasquinelli AE.
The miR-35-41 family of microRNAs regulates RNAi sensitivity in Caenorhabditis elegans.
PLoS Genet. 2012 8(3) e1002536 
[ PubMed ID = 22412382 ] [ RRC reference ]

Pavelec DM, Lachowiec J, Duchaine TF, Smith HE, Kennedy S.
Requirement for the ERI/DICER complex in endogenous RNA interference and sperm development in Caenorhabditis elegans.
Genetics 2009 183(4) 1283-95 
[ PubMed ID = 19797044 ] [ RRC reference ]

Fischer SE, Montgomery TA, Zhang C, Fahlgren N, Breen PC, Hwang A, Sullivan CM, Carrington JC, Ruvkun G.
The ERI-6/7 helicase acts at the first stage of an siRNA amplification pathway that targets recent gene duplications.
PLoS Genet. 2011 7(11) e1002369 
[ PubMed ID = 22102828 ] [ RRC reference ]

Mets DG, Meyer BJ.
Condensins regulate meiotic DNA break distribution, thus crossover frequency, by controlling chromosome structure.
Cell 2009 139(1) 73-86 
[ PubMed ID = 19781752 ] [ RRC reference ]

Von Stetina SE, Mango SE.
PAR-6, but not E-cadherin and β-integrin, is necessary for epithelial polarization in C. elegans.
Dev. Biol. 2015 403(1) 5-14 
[ PubMed ID = 25773364 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]

Billi AC, Alessi AF, Khivansara V, Han T, Freeberg M, Mitani S, Kim JK.
The Caenorhabditis elegans HEN1 ortholog, HENN-1, methylates and stabilizes select subclasses of germline small RNAs.
PLoS Genet. 2012 8(4) e1002617 
[ PubMed ID = 22548001 ] [ RRC reference ]

Conine CC, Batista PJ, Gu W, Claycomb JM, Chaves DA, Shirayama M, Mello CC.
Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3588-93 
[ PubMed ID = 20133686 ] [ RRC reference ]

Han T, Manoharan AP, Harkins TT, Bouffard P, Fitzpatrick C, Chu DS, Thierry-Mieg D, Thierry-Mieg J, Kim JK.
26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2009 106(44) 18674-9 
[ PubMed ID = 19846761 ] [ RRC reference ]

Almeida MV, Dietz S, Redl S, Karaulanov E, Hildebrandt A, Renz C, Ulrich HD, König J, Butter F, Ketting RF.
GTSF-1 is required for formation of a functional RNA-dependent RNA Polymerase complex in Caenorhabditis elegans.
EMBO J. 2018 37(12)  
[ PubMed ID = 29769402 ] [ RRC reference ]

Lu R, Yigit E, Li WX, Ding SW.
An RIG-I-Like RNA helicase mediates antiviral RNAi downstream of viral siRNA biogenesis in Caenorhabditis elegans.
PLoS Pathog. 2009 5(2) e1000286 
[ PubMed ID = 19197349 ] [ RRC reference ]

Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368 
[ PubMed ID = 29601575 ] [ RRC reference ]

Zhuang JJ, Banse SA, Hunter CP.
The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans.
Genetics 2013 194(1) 117-31 
[ PubMed ID = 23457236 ] [ RRC reference ]

Zhuang JJ, Hunter CP.
Tissue specificity of Caenorhabditis elegans enhanced RNA interference mutants.
Genetics 2011 188(1) 235-7 
[ PubMed ID = 21385728 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57 
[ PubMed ID = 17110334 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc. Natl. Acad. Sci. U.S.A. 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]