分離済み変異体

tm1860

Allele Nametm1860
Allele Type通常株
Sequence NameR09A1.1
Gene Nameergo-1
Worm BaseAllele Name tm1860
Gene Name ergo-1
Sequence R09A1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. R. Lu: PLoS Pathogens 5, e1000286 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 7750/7751-8908/8909 (1158 bp deletion)
ChromosomeV
Putative gene structurejoin(5337..6277, 7119..7303, 8644..9562, 10623..10897, 11603..11682, 12892..13754, 14495..14597)
Map position-19.85
Balancer
Map position of balancer
Sequence of primersExtRev:GAGCGGCTGCTCAGAAGACT,IntFwd:ACCCGAGCTTCCGGATGTGT,IntRev:TCTCGGTGGATCATGAGTAA,ExtFwd:AAGCGTACGAACCCGAGCTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Huang X, Ye Q, Dai W, Zheng J, Li Y, Wang C, Luo Z, Yang J, Zhuo W, Wan QL.
Cadmium exposure induces multigenerational inheritance of germ cell apoptosis and fertility suppression in Caenorhabditis elegans.
Environ Int 2024 191 108952 
[ PubMed ID = 39159515 ] [ RRC reference ]

Rogers AK, Phillips CM.
A Small-RNA-Mediated Feedback Loop Maintains Proper Levels of 22G-RNAs in C. elegans.
Cell Rep 2020 33(3) 108279 
[ PubMed ID = 33086057 ] [ RRC reference ]

Svendsen JM, Reed KJ, Vijayasarathy T, Montgomery BE, Tucci RM, Brown KC, Marks TN, Nguyen DAH, Phillips CM, Montgomery TA.
henn-1/HEN1 Promotes Germline Immortality in Caenorhabditis elegans.
Cell Rep 2019 29(10) 3187-3199.e4 
[ PubMed ID = 31801082 ] [ RRC reference ]

Posner R, Toker IA, Antonova O, Star E, Anava S, Azmon E, Hendricks M, Bracha S, Gingold H, Rechavi O.
Neuronal Small RNAs Control Behavior Transgenerationally.
Cell 2019 177(7) 1814-1826.e15 
[ PubMed ID = 31178120 ] [ RRC reference ]

Kadekar P, Roy R.
AMPK regulates germline stem cell quiescence and integrity through an endogenous small RNA pathway.
PLoS Biol 2019 17(6) e3000309 
[ PubMed ID = 31166944 ] [ RRC reference ]

Almeida MV, Dietz S, Redl S, Karaulanov E, Hildebrandt A, Renz C, Ulrich HD, König J, Butter F, Ketting RF.
GTSF-1 is required for formation of a functional RNA-dependent RNA Polymerase complex in Caenorhabditis elegans.
EMBO J 2018 37(12)  
[ PubMed ID = 29769402 ] [ RRC reference ]

Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368 
[ PubMed ID = 29601575 ] [ RRC reference ]

Greer EL, Becker B, Latza C, Antebi A, Shi Y.
Mutation of C. elegans demethylase spr-5 extends transgenerational longevity.
Cell Res 2016 26(2) 229-38 
[ PubMed ID = 26691751 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Conine CC, Batista PJ, Gu W, Claycomb JM, Chaves DA, Shirayama M, Mello CC.
Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2010 107(8) 3588-93 
[ PubMed ID = 20133686 ] [ RRC reference ]

Zhuang JJ, Hunter CP.
Tissue specificity of Caenorhabditis elegans enhanced RNA interference mutants.
Genetics 2011 188(1) 235-7 
[ PubMed ID = 21385728 ] [ RRC reference ]

Billi AC, Alessi AF, Khivansara V, Han T, Freeberg M, Mitani S, Kim JK.
The Caenorhabditis elegans HEN1 ortholog, HENN-1, methylates and stabilizes select subclasses of germline small RNAs.
PLoS Genet 2012 8(4) e1002617 
[ PubMed ID = 22548001 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Zhuang JJ, Banse SA, Hunter CP.
The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans.
Genetics 2013 194(1) 117-31 
[ PubMed ID = 23457236 ] [ RRC reference ]

Massirer KB, Perez SG, Mondol V, Pasquinelli AE.
The miR-35-41 family of microRNAs regulates RNAi sensitivity in Caenorhabditis elegans.
PLoS Genet 2012 8(3) e1002536 
[ PubMed ID = 22412382 ] [ RRC reference ]

Fischer SE, Montgomery TA, Zhang C, Fahlgren N, Breen PC, Hwang A, Sullivan CM, Carrington JC, Ruvkun G.
The ERI-6/7 helicase acts at the first stage of an siRNA amplification pathway that targets recent gene duplications.
PLoS Genet 2011 7(11) e1002369 
[ PubMed ID = 22102828 ] [ RRC reference ]

Dennis S, Sheth U, Feldman JL, English KA, Priess JR.
C. elegans germ cells show temperature and age-dependent expression of Cer1, a Gypsy/Ty3-related retrotransposon.
PLoS Pathog 2012 8(3) e1002591 
[ PubMed ID = 22479180 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]

Von Stetina SE, Mango SE.
PAR-6, but not E-cadherin and β-integrin, is necessary for epithelial polarization in C. elegans.
Dev Biol 2015 403(1) 5-14 
[ PubMed ID = 25773364 ] [ RRC reference ]