分離済み変異体

tm1857

Allele Nametm1857
BalanceNot Required
OutCrossNot Accepted
Sequence NameY45G5AM.8
Gene Namecoh-4
Worm BaseAllele Name tm1857
Gene Name coh-4
Sequence Y45G5AM.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. B. Meyer: Genes & Dev. 23, 1763 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29739/29740-AAGAAACC-30567/30568 (828 bp deletion + 8 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(25247..25365, 25415..25518, 26657..26767, 26816..26920, 27539..27879, 27933..28112, 29083..29359, 30009..30169, 30222..30388, 30443..30645, 30691..30752))
Map position-6.23
Balancer
Map position of balancer
Sequence of primersExtFwd:TAAAGCAATTCCCCCTAGAC,IntFwd:TTCCCCCTAGACATACGATT,ExtRev:GTTCGAAGCTACGCGGCACA,IntRev:TACGCGGCACACATGGGTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gordon SG, Rodriguez AA, Gu Y, Corbett KD, Lee CF, Rog O.
The synaptonemal complex aligns meiotic chromosomes by wetting.
Sci Adv 2025 11(9) eadt5675 
[ PubMed ID = 40009663 ] [ RRC reference ]

Gordon SG, Rodriguez AA, Gu Y, Corbett KD, Lee CF, Rog O.
The synaptonemal complex aligns meiotic chromosomes by wetting.
bioRxiv 2024   
[ PubMed ID = 39149313 ] [ RRC reference ]

Castellano-Pozo M, Sioutas G, Barroso C, Prince JP, Lopez-Jimenez P, Davy J, Jaso-Tamame AL, Crawley O, Shao N, Page J, Martinez-Perez E.
The kleisin subunit controls the function of C. elegans meiotic cohesins by determining the mode of DNA binding and differential regulation by SCC-2 and WAPL-1.
Elife 2023 12  
[ PubMed ID = 37650378 ] [ RRC reference ]

Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K.
A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes.
EMBO J 2023 42(11) e105002 
[ PubMed ID = 37078421 ] [ RRC reference ]

Castellano-Pozo M, Pacheco S, Sioutas G, Jaso-Tamame AL, Dore MH, Karimi MM, Martinez-Perez E.
Surveillance of cohesin-supported chromosome structure controls meiotic progression.
Nat Commun 2020 11(1) 4345 
[ PubMed ID = 32859945 ] [ RRC reference ]

Woglar A, Yamaya K, Roelens B, Boettiger A, Köhler S, Villeneuve AM.
Quantitative cytogenetics reveals molecular stoichiometry and longitudinal organization of meiotic chromosome axes and loops.
PLoS Biol 2020 18(8) e3000817 
[ PubMed ID = 32813728 ] [ RRC reference ]

Billmyre KK, Doebley AL, Spichal M, Heestand B, Belicard T, Sato-Carlton A, Flibotte S, Simon M, Gnazzo M, Skop A, Moerman D, Carlton PM, Sarkies P, Ahmed S.
The meiotic phosphatase GSP-2/PP1 promotes germline immortality and small RNA-mediated genome silencing.
PLoS Genet 2019 15(3) e1008004 
[ PubMed ID = 30921322 ] [ RRC reference ]

Bowman R, Balukof N, Ford T, Smolikove S.
A Novel Role for α-Importins and Akirin in Establishment of Meiotic Sister Chromatid Cohesion in Caenorhabditis elegans.
Genetics 2019 211(2) 617-635 
[ PubMed ID = 30563860 ] [ RRC reference ]

Hernandez MR, Davis MB, Jiang J, Brouhard EA, Severson AF, Csankovszki G.
Condensin I protects meiotic cohesin from WAPL-1 mediated removal.
PLoS Genet 2018 14(5) e1007382 
[ PubMed ID = 29768402 ] [ RRC reference ]

Rog O, Köhler S, Dernburg AF.
The synaptonemal complex has liquid crystalline properties and spatially regulates meiotic recombination factors.
Elife 2017 6  
[ PubMed ID = 28045371 ] [ RRC reference ]

Crawley O, Barroso C, Testori S, Ferrandiz N, Silva N, Castellano-Pozo M, Jaso-Tamame AL, Martinez-Perez E.
Cohesin-interacting protein WAPL-1 regulates meiotic chromosome structure and cohesion by antagonizing specific cohesin complexes.
Elife 2016 5 e10851 
[ PubMed ID = 26841696 ] [ RRC reference ]

Severson AF, Meyer BJ.
Divergent kleisin subunits of cohesin specify mechanisms to tether and release meiotic chromosomes.
Elife 2014 3 e03467 
[ PubMed ID = 25171895 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol 2012 10(8) e1001378 
[ PubMed ID = 22927794 ] [ RRC reference ]

Severson AF, Ling L, van Zuylen V, Meyer BJ.
The axial element protein HTP-3 promotes cohesin loading and meiotic axis assembly in C. elegans to implement the meiotic program of chromosome segregation.
Genes Dev 2009 23(15) 1763-78 
[ PubMed ID = 19574299 ] [ RRC reference ]