Home > Mutants (Isolated) > tm1826

Mutants (Isolated)

Allele Name		tm1826
Allele Type		Normal
Sequence Name		F56D2.7
Gene Name		ced-6
Worm Base	Allele Name	tm1826
	Gene Name	ced-6
	Sequence	F56D2.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. K. Matsumoto: localization of APL-1::GFP protein was not altered. Dr. M. Hengartner: defective in engulfment of apoptotic cells.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		17698/17699-CGA-18202/18203 (504 bp deletion + 3 bp insertion)
Chromosome		III
Putative gene structure		join(17222..17375, 17720..17997, 18156..18446, 18496..18934, 18985..19301)
Map position		-1.53
Balancer
Map position of balancer
Sequence of primers		ExtRev:GGTGTTCCATAATCGCTTTC,IntFwd:AAGACCTTCAAACGATCGGT,ExtFwd:CGGACCCACCAAAAGAACCT,IntRev:GCTGCCCGAACTCAAATGAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Harders RH, Morthorst TH, Lande AD, Hesselager MO, Mandrup OA, Bendixen E, Stensballe A, Olsen A. Dynein links engulfment and execution of apoptosis via CED-4/Apaf1 in C. elegans. Cell Death Dis 2018 9(10) 1012  [ PubMed ID = 30262881 ] [ RRC reference ] Pinto SM, Almendinger J, Cabello J, Hengartner MO. Loss of Acetylcholine Signaling Reduces Cell Clearance Deficiencies in Caenorhabditis elegans. PLoS One 2016 11(2) e0149274  [ PubMed ID = 26872385 ] [ RRC reference ] Neukomm LJ, Frei AP, Cabello J, Kinchen JM, Zaidel-Bar R, Ma Z, Haney LB, Hardin J, Ravichandran KS, Moreno S, Hengartner MO. Loss of the RhoGAP SRGP-1 promotes the clearance of dead and injured cells in Caenorhabditis elegans. Nat Cell Biol 2011 13(1) 79-86  [ PubMed ID = 21170032 ] [ RRC reference ] Neukomm LJ, Nicot AS, Kinchen JM, Almendinger J, Pinto SM, Zeng S, Doukoumetzidis K, Tronchère H, Payrastre B, Laporte JF, Hengartner MO. The phosphoinositide phosphatase MTM-1 regulates apoptotic cell corpse clearance through CED-5-CED-12 in C. elegans. Development 2011 138(10) 2003-14  [ PubMed ID = 21490059 ] [ RRC reference ] Morthorst TH, Olsen A. Cell-nonautonomous inhibition of radiation-induced apoptosis by dynein light chain 1 in Caenorhabditis elegans. Cell Death Dis 2013 4(9) e799  [ PubMed ID = 24030151 ] [ RRC reference ] Neukomm LJ, Zeng S, Frei AP, Huegli PA, Hengartner MO. Small GTPase CDC-42 promotes apoptotic cell corpse clearance in response to PAT-2 and CED-1 in C. elegans. Cell Death Differ 2014 21(6) 845-53  [ PubMed ID = 24632947 ] [ RRC reference ]