| Allele Name | tm1821 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | T26A5.7 |
| Gene Name | set-1 |
| Worm Base | Allele Name |
tm1821
(x1) |
| Gene Name |
set-1
|
| Sequence |
T26A5.7
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. R.H. Horvitz: recessive sterile, not synMuv with class A or B mutations and not a synMuv suppressor. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3813/3814-4744/4745 (931 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(3510..3647, 3736..3923, 3978..4216, 4350..4529, 4634..4755)) |
| Map position | -1.26 |
| Balancer | hT2 |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CGCACCTCATGTACACCACA,IntFwd:GTAATGAGAGGATTGGGCAC,ExtRev:GCACTTCCCGCCAAAACCAT,IntRev:ATTTAGTCGCGTGTGCACGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Kramer M, Kranz AL, Su A, Winterkorn LH, Albritton SE, Ercan S. Developmental Dynamics of X-Chromosome Dosage Compensation by the DCC and H4K20me1 in C. elegans. PLoS Genet 2015 11(12) e1005698
[ PubMed ID = 26641248 ]
[ RRC reference ]
|
Lau AC, Nabeshima K, Csankovszki G. The C. elegans dosage compensation complex mediates interphase X chromosome compaction. Epigenetics Chromatin 2014 7(1) 31
[ PubMed ID = 25400696 ]
[ RRC reference ]
|
Vielle A, Lang J, Dong Y, Ercan S, Kotwaliwale C, Rechtsteiner A, Appert A, Chen QB, Dose A, Egelhofer T, Kimura H, Stempor P, Dernburg A, Lieb JD, Strome S, Ahringer J. H4K20me1 contributes to downregulation of X-linked genes for C. elegans dosage compensation. PLoS Genet 2012 8(9) e1002933
[ PubMed ID = 23028348 ]
[ RRC reference ]
|
Wells MB, Snyder MJ, Custer LM, Csankovszki G. Caenorhabditis elegans dosage compensation regulates histone H4 chromatin state on X chromosomes. Mol Cell Biol 2012 32(9) 1710-9
[ PubMed ID = 22393255 ]
[ RRC reference ]
|
|