Mutants (Isolated)

tm1819

Allele Nametm1819
Sequence NameC17E7.1
CGC Namenhr-156
Worm BaseAllele Name tm1819
CGC Name nhr-156
Sequence C17E7.1
Phenotypehomozygous viable. Dr. K. Ashrafi: normal fat content observed by Nile-Red staining.
Mutation site42042/42043-42595/42596 (553 bp deletion)
ChromosomeV
Putative gene structurejoin(42309..42424, 42481..42543, 42598..42656, 42700..43115)
Map position-7.59
Balancer
Map position of balancer
Sequence of primersExtRev:TACTCCCAGCAATCCGCCGT,IntFwd:CGCGTCTGCGGAAACATGAC,ExtFwd:CCTCAACGCGTCTGCGGAAA,IntRev:CGAATCCATTCGCCAGCTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]