| Allele Name | tm1819 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C17E7.1 |
| Gene Name | nhr-156 |
| Worm Base | Allele Name |
tm1819
|
| Gene Name |
nhr-156
|
| Sequence |
C17E7.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. K. Ashrafi: normal fat content observed by Nile-Red staining. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 42042/42043-42595/42596 (553 bp deletion) |
| Chromosome | V |
| Putative gene structure | join(42309..42424, 42481..42543, 42598..42656, 42700..43115) |
| Map position | -7.59 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:TACTCCCAGCAATCCGCCGT,IntFwd:CGCGTCTGCGGAAACATGAC,ExtFwd:CCTCAACGCGTCTGCGGAAA,IntRev:CGAATCCATTCGCCAGCTTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wallace SW, Lizzappi MC, Magemizoğlu E, Hur H, Liang Y, Shaham S. Nuclear hormone receptors promote gut and glia detoxifying enzyme induction and protect C. elegans from the mold P. brevicompactum. Cell Rep 2021 37(13) 110166
[ PubMed ID = 34965433 ]
[ RRC reference ]
|
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A. Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans. Cell Rep 2016 16(1) 56-65
[ PubMed ID = 27320929 ]
[ RRC reference ]
|
|