Mutants (Isolated)

tm1817

Allele Nametm1817
Sequence NameD2030.9
CGC Namewdr-23
Worm BaseAllele Name tm1817
CGC Name wdr-23
Sequence D2030.9
Phenotypehomozygous viable. Dr. C.P. Hunter: no growth or fertility defects at 20C. Dr. J. Kaplan: resistant to aldicarb, Unc. Dr. K. Strange: Gro, small brood size, Emb.
Mutation site34358/34359-34993/34994 (635 bp deletion)
ChromosomeI
Putative gene structurejoin(32141..32179, 33263..33403, 33789..34038, 34088..34334, 34393..34603, 35121..35300, 35378..35588, 36248..36354, 36664..36870)
Map position2.2
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTACAGTAACCGCCCGTTG,IntRev:ATGGCATGCAAGCAATGTCA,IntFwd:GACTGACGCAACACGGGTCT,ExtRev:CCATGCACGTTTGTCCCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wu CW, Wang Y, Choe KP.
F-Box Protein XREP-4 Is a New Regulator of the Oxidative Stress Response in Caenorhabditis elegans.
Genetics 2017 206(2) 859-871 
[ PubMed ID = 28341649 ] [ RRC reference ]

Leung CK, Hasegawa K, Wang Y, Deonarine A, Tang L, Miwa J, Choe KP.
Direct interaction between the WD40 repeat protein WDR-23 and SKN-1/Nrf inhibits binding to target DNA.
Mol. Cell. Biol. 2014 34(16) 3156-67 
[ PubMed ID = 24912676 ] [ RRC reference ]

Leung CK, Wang Y, Deonarine A, Tang L, Prasse S, Choe KP.
A negative-feedback loop between the detoxification/antioxidant response factor SKN-1 and its repressor WDR-23 matches organism needs with environmental conditions.
Mol. Cell. Biol. 2013 33(17) 3524-37 
[ PubMed ID = 23836880 ] [ RRC reference ]

Choe KP, Przybysz AJ, Strange K.
The WD40 repeat protein WDR-23 functions with the CUL4/DDB1 ubiquitin ligase to regulate nuclear abundance and activity of SKN-1 in Caenorhabditis elegans.
Mol. Cell. Biol. 2009 29(10) 2704-15 
[ PubMed ID = 19273594 ] [ RRC reference ]

Ewald CY, Landis JN, Porter Abate J, Murphy CT, Blackwell TK.
Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling in longevity.
Nature 2015 519(7541) 97-101 
[ PubMed ID = 25517099 ] [ RRC reference ]

Offenburger SL, Jongsma E, Gartner A.
Mutations in Caenorhabditis elegans neuroligin-like glit-1, the apoptosis pathway and the calcium chaperone crt-1 increase dopaminergic neurodegeneration after 6-OHDA treatment.
PLoS Genet. 2018 14(1) e1007106 
[ PubMed ID = 29346364 ] [ RRC reference ]

Staab TA, Griffen TC, Corcoran C, Evgrafov O, Knowles JA, Sieburth D.
The conserved SKN-1/Nrf2 stress response pathway regulates synaptic function in Caenorhabditis elegans.
PLoS Genet. 2013 9(3) e1003354 
[ PubMed ID = 23555279 ] [ RRC reference ]

Staab TA, Evgrafov O, Knowles JA, Sieburth D.
Regulation of synaptic nlg-1/neuroligin abundance by the skn-1/Nrf stress response pathway protects against oxidative stress.
PLoS Genet. 2014 10(1) e1004100 
[ PubMed ID = 24453991 ] [ RRC reference ]

Goh GY, Martelli KL, Parhar KS, Kwong AW, Wong MA, Mah A, Hou NS, Taubert S.
The conserved Mediator subunit MDT-15 is required for oxidative stress responses in Caenorhabditis elegans.
Aging Cell 2014 13(1) 70-9 
[ PubMed ID = 23957350 ] [ RRC reference ]