Mutants (Isolated)

tm1817

Allele Nametm1817
Allele TypeNormal
Sequence NameD2030.9
Gene Namewdr-23
Worm BaseAllele Name tm1817
Gene Name wdr-23
Sequence D2030.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C.P. Hunter: no growth or fertility defects at 20C. Dr. J. Kaplan: resistant to aldicarb, Unc. Dr. K. Strange: Gro, small brood size, Emb.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 34358/34359-34993/34994 (635 bp deletion)
ChromosomeI
Putative gene structurejoin(31474..31577, 31637..31713, 33263..33403, 33789..34038, 34088..34334, 34393..34603, 35121..35300, 35378..35588, 36248..36354, 36664..37174)
Map position2.2
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTACAGTAACCGCCCGTTG,IntRev:ATGGCATGCAAGCAATGTCA,IntFwd:GACTGACGCAACACGGGTCT,ExtRev:CCATGCACGTTTGTCCCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim E, Annibal A, Lee Y, Park HH, Ham S, Jeong DE, Kim Y, Park S, Kwon S, Jung Y, Park J, Kim SS, Antebi A, Lee SV.
Mitochondrial aconitase suppresses immunity by modulating oxaloacetate and the mitochondrial unfolded protein response.
Nat Commun 2023 14(1) 3716 
[ PubMed ID = 37349299 ] [ RRC reference ]

Spatola BN, Lo JY, Wang B, Curran SP.
Nuclear and cytoplasmic WDR-23 isoforms mediate differential effects on GEN-1 and SKN-1 substrates.
Sci Rep 2019 9(1) 11783 
[ PubMed ID = 31409866 ] [ RRC reference ]

Ganner A, Gerber J, Ziegler AK, Li Y, Kandzia J, Matulenski T, Kreis S, Breves G, Klein M, Walz G, Neumann-Haefelin E.
CBP-1/p300 acetyltransferase regulates SKN-1/Nrf cellular levels, nuclear localization, and activity in C. elegans.
Exp Gerontol 2019 126 110690 
[ PubMed ID = 31419472 ] [ RRC reference ]

Mohankumar A, Shanmugam G, Kalaiselvi D, Levenson C, Nivitha S, Thiruppathi G, Sundararaj P.
East Indian sandalwood (Santalum album L.) oil confers neuroprotection and geroprotection in Caenorhabditis elegans via activating SKN-1/Nrf2 signaling pathway.
RSC Adv 2018 8(59) 33753-33774 
[ PubMed ID = 30319772 ] [ RRC reference ]

Hu Q, D'Amora DR, MacNeil LT, Walhout AJM, Kubiseski TJ.
The Caenorhabditis elegans Oxidative Stress Response Requires the NHR-49 Transcription Factor.
G3 (Bethesda) 2018 8(12) 3857-3863 
[ PubMed ID = 30297383 ] [ RRC reference ]

Kim S, Sieburth D.
Sphingosine Kinase Regulates Neuropeptide Secretion During the Oxidative Stress-Response Through Intertissue Signaling.
J Neurosci 2018 38(38) 8160-8176 
[ PubMed ID = 30082417 ] [ RRC reference ]

Tang L, Dodd W, Choe K.
Isolation of a Hypomorphic skn-1 Allele That Does Not Require a Balancer for Maintenance.
G3 (Bethesda) 2015 6(3) 551-8 
[ PubMed ID = 26715089 ] [ RRC reference ]

Wu CW, Deonarine A, Przybysz A, Strange K, Choe KP.
The Skp1 Homologs SKR-1/2 Are Required for the Caenorhabditis elegans SKN-1 Antioxidant/Detoxification Response Independently of p38 MAPK.
PLoS Genet 2016 12(10) e1006361 
[ PubMed ID = 27776126 ] [ RRC reference ]

Crombie TA, Tang L, Choe KP, Julian D.
Inhibition of the oxidative stress response by heat stress in Caenorhabditis elegans.
J Exp Biol 2016 219(Pt 14) 2201-11 
[ PubMed ID = 27207646 ] [ RRC reference ]

Offenburger SL, Jongsma E, Gartner A.
Mutations in Caenorhabditis elegans neuroligin-like glit-1, the apoptosis pathway and the calcium chaperone crt-1 increase dopaminergic neurodegeneration after 6-OHDA treatment.
PLoS Genet 2018 14(1) e1007106 
[ PubMed ID = 29346364 ] [ RRC reference ]

Wu CW, Wang Y, Choe KP.
F-Box Protein XREP-4 Is a New Regulator of the Oxidative Stress Response in Caenorhabditis elegans.
Genetics 2017 206(2) 859-871 
[ PubMed ID = 28341649 ] [ RRC reference ]

Staab TA, Griffen TC, Corcoran C, Evgrafov O, Knowles JA, Sieburth D.
The conserved SKN-1/Nrf2 stress response pathway regulates synaptic function in Caenorhabditis elegans.
PLoS Genet 2013 9(3) e1003354 
[ PubMed ID = 23555279 ] [ RRC reference ]

Staab TA, Evgrafov O, Knowles JA, Sieburth D.
Regulation of synaptic nlg-1/neuroligin abundance by the skn-1/Nrf stress response pathway protects against oxidative stress.
PLoS Genet 2014 10(1) e1004100 
[ PubMed ID = 24453991 ] [ RRC reference ]

Leung CK, Wang Y, Deonarine A, Tang L, Prasse S, Choe KP.
A negative-feedback loop between the detoxification/antioxidant response factor SKN-1 and its repressor WDR-23 matches organism needs with environmental conditions.
Mol Cell Biol 2013 33(17) 3524-37 
[ PubMed ID = 23836880 ] [ RRC reference ]

Goh GY, Martelli KL, Parhar KS, Kwong AW, Wong MA, Mah A, Hou NS, Taubert S.
The conserved Mediator subunit MDT-15 is required for oxidative stress responses in Caenorhabditis elegans.
Aging Cell 2014 13(1) 70-9 
[ PubMed ID = 23957350 ] [ RRC reference ]

Leung CK, Hasegawa K, Wang Y, Deonarine A, Tang L, Miwa J, Choe KP.
Direct interaction between the WD40 repeat protein WDR-23 and SKN-1/Nrf inhibits binding to target DNA.
Mol Cell Biol 2014 34(16) 3156-67 
[ PubMed ID = 24912676 ] [ RRC reference ]

Ewald CY, Landis JN, Porter Abate J, Murphy CT, Blackwell TK.
Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling in longevity.
Nature 2015 519(7541) 97-101 
[ PubMed ID = 25517099 ] [ RRC reference ]

Choe KP, Przybysz AJ, Strange K.
The WD40 repeat protein WDR-23 functions with the CUL4/DDB1 ubiquitin ligase to regulate nuclear abundance and activity of SKN-1 in Caenorhabditis elegans.
Mol Cell Biol 2009 29(10) 2704-15 
[ PubMed ID = 19273594 ] [ RRC reference ]