Mutants (Isolated)

tm1815

Allele Nametm1815
Sequence NameF01E11.5
CGC Nametyra-2
Worm BaseAllele Name tm1815
CGC Name tyra-2
Sequence F01E11.5
Phenotypehomozygous viable. Dr. H. Horvitz: normal serotonin resistance.
Mutation site37497/37498-37851/37852 (354 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(32555..32635,32688..32799,32847..32978, 33033..33223, 33270..33370, 34314..34413, 36372..36566, 36613..36800, 37061..37181, 37230..37475))
Map position-1.93
Balancer
Map position of balancer
Sequence of primersIntFwd:TACATGAGACGAGACGGCCA,ExtFwd:GTGCTCTATAGCTATGGGGA,IntRev:GCAGTCCCGGATTTTATTTG,ExtRev:GTCGACAACATGGGAGTTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Donnelly JL, Clark CM, Leifer AM, Pirri JK, Haburcak M, Francis MM, Samuel AD, Alkema MJ.
Monoaminergic orchestration of motor programs in a complex C. elegans behavior.
PLoS Biol. 2013 11(4) e1001529 
[ PubMed ID = 23565061 ] [ RRC reference ]

Guo M, Wu TH, Song YX, Ge MH, Su CM, Niu WP, Li LL, Xu ZJ, Ge CL, Al-Mhanawi MT, Wu SP, Wu ZX.
Reciprocal inhibition between sensory ASH and ASI neurons modulates nociception and avoidance in Caenorhabditis elegans.
Nat Commun 2015 6 5655 
[ PubMed ID = 25585042 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res. 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]