分離済み変異体

tm1811

Allele Nametm1811
Allele Type通常株
Sequence NameZC506.4
Gene Namemgl-1
Worm BaseAllele Name tm1811
Gene Name mgl-1
Sequence ZC506.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I Mori: normal thermotaxis. Dr. I. Katsura: normal avoidance behavior to 2-nonanone. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. J. Kaplan: wild type locomotion. Dr. L. Avery: Genes & Dev. 23, 12 (2009)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15030/15031-15889/15890 (859 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(11961..12120, 12523..12668, 12718..12965, 13008..13080, 13123..13381, 13671..13909, 13951..14052, 14110..14469, 14515..14611, 14983..15354, 15433..15547, 15663..15772, 15818..16006, 16129..16238, 16283..16364, 16422..16528, 17131..17166, 17254..17353, 17640..17734))
Map position1.73
Balancer
Map position of balancer
Sequence of primersExtFwd:CATCATCTGGACATATCGCT,IntFwd:AGCCCATGAGCAATGGCATA,ExtRev:AATGCACCGAGGCTGAATTA,IntRev:TCCGAATACCCGGAGATATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Motomura H, Ioroi M, Murakami K, Kuhara A, Ohta A.
Head-tail-head neural wiring underlies gut fat storage in Caenorhabditis elegans temperature acclimation.
Proc Natl Acad Sci U S A 2022 119(32) e2203121119 
[ PubMed ID = 35914124 ] [ RRC reference ]

Liu H, Wu JJ, Li R, Wang PZ, Huang JH, Xu Y, Zhao JL, Wu PP, Li SJ, Wu ZX.
Disexcitation in the ASH/RIM/ADL negative feedback circuit fine-tunes hyperosmotic sensation and avoidance in Caenorhabditis elegans.
Front Mol Neurosci 2023 16 1101628 
[ PubMed ID = 37008778 ] [ RRC reference ]

Chai CM, Torkashvand M, Seyedolmohadesin M, Park H, Venkatachalam V, Sternberg PW.
Interneuron control of C. elegans developmental decision-making.
Curr Biol 2022 32(10) 2316-2324.e4 
[ PubMed ID = 35447086 ] [ RRC reference ]

Kang C, Avery L.
The FMRFamide Neuropeptide FLP-20 Acts as a Systemic Signal for Starvation Responses in Caenorhabditis elegans.
Mol Cells 2021 44(7) 529-537 
[ PubMed ID = 34140426 ] [ RRC reference ]

Wang M, Witvliet D, Wu M, Kang L, Shao Z.
Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling.
PLoS Genet 2021 17(1) e1009295 
[ PubMed ID = 33428618 ] [ RRC reference ]

Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX.
Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions.
iScience 2020 23(10) 101588 
[ PubMed ID = 33089099 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Katz M, Corson F, Keil W, Singhal A, Bae A, Lu Y, Liang Y, Shaham S.
Glutamate spillover in C. elegans triggers repetitive behavior through presynaptic activation of MGL-2/mGluR5.
Nat Commun 2019 10(1) 1882 
[ PubMed ID = 31015396 ] [ RRC reference ]

Kuramochi M, Doi M.
An Excitatory/Inhibitory Switch From Asymmetric Sensory Neurons Defines Postsynaptic Tuning for a Rapid Response to NaCl in Caenorhabditis elegans.
Front Mol Neurosci 2018 11 484 
[ PubMed ID = 30687001 ] [ RRC reference ]

Dillon J, Holden-Dye L, O'Connor V.
Yeast two-hybrid screening identifies MPZ-1 and PTP-1 as candidate scaffolding proteins of metabotropic glutamate receptors in Caenorhabditis elegans.
Invert Neurosci 2018 18(4) 16 
[ PubMed ID = 30417267 ] [ RRC reference ]

Jeong H, Paik YK.
MGL-1 on AIY neurons translates starvation to reproductive plasticity via neuropeptide signaling in Caenorhabditis elegans.
Dev Biol 2017 430(1) 80-89 
[ PubMed ID = 28807780 ] [ RRC reference ]

Park D, Hahm JH, Park S, Ha G, Chang GE, Jeong H, Kim H, Kim S, Cheong E, Paik YK.
A conserved neuronal DAF-16/FoxO plays an important role in conveying pheromone signals to elicit repulsion behavior in Caenorhabditis elegans.
Sci Rep 2017 7(1) 7260 
[ PubMed ID = 28775361 ] [ RRC reference ]

Ohnishi N, Kuhara A, Nakamura F, Okochi Y, Mori I.
Bidirectional regulation of thermotaxis by glutamate transmissions in Caenorhabditis elegans.
EMBO J 2011 30(7) 1376-88 
[ PubMed ID = 21304490 ] [ RRC reference ]

Hyde R, Corkins ME, Somers GA, Hart AC.
PKC-1 acts with the ERK MAPK signaling pathway to regulate Caenorhabditis elegans mechanosensory response.
Genes Brain Behav 2011 10(3) 286-98 
[ PubMed ID = 21143768 ] [ RRC reference ]

Lemieux GA, Keiser MJ, Sassano MF, Laggner C, Mayer F, Bainton RJ, Werb Z, Roth BL, Shoichet BK, Ashrafi K.
In silico molecular comparisons of C. elegans and mammalian pharmacology identify distinct targets that regulate feeding.
PLoS Biol 2013 11(11) e1001712 
[ PubMed ID = 24260022 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J Neurosci 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Dillon J, Franks CJ, Murray C, Edwards RJ, Calahorro F, Ishihara T, Katsura I, Holden-Dye L, O'Connor V.
Metabotropic Glutamate Receptors: MODULATORS OF CONTEXT-DEPENDENT FEEDING BEHAVIOUR IN C. ELEGANS.
J Biol Chem 2015 290(24) 15052-65 
[ PubMed ID = 25869139 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr Biol 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Kang C, Avery L.
Systemic regulation of starvation response in Caenorhabditis elegans.
Genes Dev 2009 23(1) 12-7 
[ PubMed ID = 19136622 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]