Mutants (Isolated)

tm1811

Allele Nametm1811
Sequence NameZC506.4
CGC Namemgl-1
Worm BaseAllele Name tm1811
CGC Name mgl-1
Sequence ZC506.4
Phenotypehomozygous viable. Dr. I Mori: normal thermotaxis. Dr. I. Katsura: normal avoidance behavior to 2-nonanone. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. J. Kaplan: wild type locomotion. Dr. L. Avery: Genes & Dev. 23, 12 (2009)
Mutation site15030/15031-15889/15890 (859 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(11961..12120, 12523..12668, 12718..12965, 13008..13080, 13123..13381, 13671..13909, 13951..14052, 14110..14469, 14515..14611, 14983..15354, 15433..15547, 15663..15772, 15818..16006, 16129..16238, 16283..16364, 16422..16528, 17131..17166, 17254..17353, 17640..17734))
Map position1.73
Balancer
Map position of balancer
Sequence of primersExtFwd:CATCATCTGGACATATCGCT,IntFwd:AGCCCATGAGCAATGGCATA,ExtRev:AATGCACCGAGGCTGAATTA,IntRev:TCCGAATACCCGGAGATATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Katz M, Corson F, Keil W, Singhal A, Bae A, Lu Y, Liang Y, Shaham S.
Glutamate spillover in C. elegans triggers repetitive behavior through presynaptic activation of MGL-2/mGluR5.
Nat Commun 2019 10(1) 1882 
[ PubMed ID = 31015396 ] [ RRC reference ]

Park D, Hahm JH, Park S, Ha G, Chang GE, Jeong H, Kim H, Kim S, Cheong E, Paik YK.
A conserved neuronal DAF-16/FoxO plays an important role in conveying pheromone signals to elicit repulsion behavior in Caenorhabditis elegans.
Sci Rep 2017 7(1) 7260 
[ PubMed ID = 28775361 ] [ RRC reference ]

Ohnishi N, Kuhara A, Nakamura F, Okochi Y, Mori I.
Bidirectional regulation of thermotaxis by glutamate transmissions in Caenorhabditis elegans.
EMBO J. 2011 30(7) 1376-88 
[ PubMed ID = 21304490 ] [ RRC reference ]

Hyde R, Corkins ME, Somers GA, Hart AC.
PKC-1 acts with the ERK MAPK signaling pathway to regulate Caenorhabditis elegans mechanosensory response.
Genes Brain Behav. 2011 10(3) 286-98 
[ PubMed ID = 21143768 ] [ RRC reference ]

Jeong H, Paik YK.
MGL-1 on AIY neurons translates starvation to reproductive plasticity via neuropeptide signaling in Caenorhabditis elegans.
Dev. Biol. 2017 430(1) 80-89 
[ PubMed ID = 28807780 ] [ RRC reference ]

Dillon J, Franks CJ, Murray C, Edwards RJ, Calahorro F, Ishihara T, Katsura I, Holden-Dye L, O'Connor V.
Metabotropic Glutamate Receptors: MODULATORS OF CONTEXT-DEPENDENT FEEDING BEHAVIOUR IN C. ELEGANS.
J. Biol. Chem. 2015 290(24) 15052-65 
[ PubMed ID = 25869139 ] [ RRC reference ]

Lemieux GA, Keiser MJ, Sassano MF, Laggner C, Mayer F, Bainton RJ, Werb Z, Roth BL, Shoichet BK, Ashrafi K.
In silico molecular comparisons of C. elegans and mammalian pharmacology identify distinct targets that regulate feeding.
PLoS Biol. 2013 11(11) e1001712 
[ PubMed ID = 24260022 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr. Biol. 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Kang C, Avery L.
Systemic regulation of starvation response in Caenorhabditis elegans.
Genes Dev. 2009 23(1) 12-7 
[ PubMed ID = 19136622 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab. 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]