Mutants (Isolated)

tm1799

Allele Nametm1799
Sequence NameF53B3.6
CGC NameF53B3.6
Worm BaseAllele Name tm1799
CGC Name F53B3.6
Sequence F53B3.6
Phenotypehomozygous viable
Mutation site16091/16092-16650/16651 (559 bp deletion)
ChromosomeX
Putative gene structurejoin(16562..16809, 16866..17583)
Map position-12.69
Balancer
Map position of balancer
Sequence of primersExtFwd:CACCTACTATGGCGCTACTC,IntRev:ATACCTGTGGCTGTTGAGTG,ExtRev:TCGTAGCTCCATGGTGGCCA,IntFwd:TGGAGGGAACGAAACTCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM.
Mutations in Fis1 disrupt orderly disposal of defective mitochondria.
Mol. Biol. Cell 2014 25(1) 145-59 
[ PubMed ID = 24196833 ] [ RRC reference ]