Mutants (Isolated)

tm1799

Allele Nametm1799
Allele TypeNormal
Sequence NameF53B3.6
Gene NameF53B3.6
Worm BaseAllele Name tm1799
Gene Name F53B3.6
Sequence F53B3.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16091/16092-16650/16651 (559 bp deletion)
ChromosomeX
Putative gene structurejoin(16562..16809, 16866..17583)
Map position-12.69
Balancer
Map position of balancer
Sequence of primersExtFwd:CACCTACTATGGCGCTACTC,IntRev:ATACCTGTGGCTGTTGAGTG,ExtRev:TCGTAGCTCCATGGTGGCCA,IntFwd:TGGAGGGAACGAAACTCATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Oh KH, Sheoran S, Richmond JE, Kim H.
Alcohol induces mitochondrial fragmentation and stress responses to maintain normal muscle function in Caenorhabditis elegans.
FASEB J 2020 34(6) 8204-8216 
[ PubMed ID = 32294300 ] [ RRC reference ]

Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM.
Mutations in Fis1 disrupt orderly disposal of defective mitochondria.
Mol Biol Cell 2014 25(1) 145-59 
[ PubMed ID = 24196833 ] [ RRC reference ]