Mutants (Isolated)

tm1791

Allele Nametm1791
BalanceNot Required
OutCrossNot Accepted
Sequence NameC03D6.6
Gene NameC03D6.6
Worm BaseAllele Name tm1791
Gene Name C03D6.6
Sequence C03D6.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. DDr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 894/895-1315/1316 (421 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(350..544, 596..718, 765..864, 911..978))
Map position3.83
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGTCGGAATCCTCGGATGT,IntFwd:TCCTCGGATGTATCGGAATC,IntRev:TTGGGAATGTGGTGACGCGA,ExtRev:CGACTGGATCCTCATCAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang R, Li J, Tian Y, Sun Y, Zhang Y, Liu M, Zhang R, Zhao L, Li Q, Meng X, Zhou J, Gao J.
The dynamic recruitment of LAB proteins senses meiotic chromosome axis differentiation in C. elegans.
J Cell Biol 2024 223(2)  
[ PubMed ID = 38010234 ] [ RRC reference ]

Liu Y, Zhao Q, Nie H, Zhang F, Fu T, Zhang Z, Qi F, Wang R, Zhou J, Gao J.
SYP-5 regulates meiotic thermotolerance in Caenorhabditis elegans.
J Mol Cell Biol 2021 13(9) 662-675 
[ PubMed ID = 34081106 ] [ RRC reference ]

Brandt JN, Hussey KA, Kim Y.
Spatial and temporal control of targeting Polo-like kinase during meiotic prophase.
J Cell Biol 2020 219(11)  
[ PubMed ID = 32997737 ] [ RRC reference ]

Billmyre KK, Doebley AL, Spichal M, Heestand B, Belicard T, Sato-Carlton A, Flibotte S, Simon M, Gnazzo M, Skop A, Moerman D, Carlton PM, Sarkies P, Ahmed S.
The meiotic phosphatase GSP-2/PP1 promotes germline immortality and small RNA-mediated genome silencing.
PLoS Genet 2019 15(3) e1008004 
[ PubMed ID = 30921322 ] [ RRC reference ]

Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E.
Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis.
Nat Commun 2018 9(1) 834 
[ PubMed ID = 29483514 ] [ RRC reference ]

Tzur YB, Friedland AE, Nadarajan S, Church GM, Calarco JA, Colaiácovo MP.
Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR-Cas9 system.
Genetics 2013 195(3) 1181-5 
[ PubMed ID = 23979579 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol 2012 10(8) e1001378 
[ PubMed ID = 22927794 ] [ RRC reference ]

de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]