Mutants (Isolated)

tm1791

Allele Nametm1791
Sequence NameC03D6.6
CGC NameC03D6.6
Worm BaseAllele Name tm1791
CGC Name C03D6.6
Sequence C03D6.6
Phenotypehomozygous viable. DDr. M. Colaiacovo: Genes & Dev, 22, 2869 (2008)
Mutation site894/895-1315/1316 (421 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(350..544, 596..718, 765..864, 911..978))
Map position3.83
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGTCGGAATCCTCGGATGT,IntFwd:TCCTCGGATGTATCGGAATC,IntRev:TTGGGAATGTGGTGACGCGA,ExtRev:CGACTGGATCCTCATCAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tzur YB, Friedland AE, Nadarajan S, Church GM, Calarco JA, Colaiácovo MP.
Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR-Cas9 system.
Genetics 2013 195(3) 1181-5 
[ PubMed ID = 23979579 ] [ RRC reference ]

Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E.
Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis.
Nat Commun 2018 9(1) 834 
[ PubMed ID = 29483514 ] [ RRC reference ]

Tzur YB, Egydio de Carvalho C, Nadarajan S, Van Bostelen I, Gu Y, Chu DS, Cheeseman IM, Colaiácovo MP.
LAB-1 targets PP1 and restricts Aurora B kinase upon entrance into meiosis to promote sister chromatid cohesion.
PLoS Biol. 2012 10(8) e1001378 
[ PubMed ID = 22927794 ] [ RRC reference ]

de Carvalho CE, Zaaijer S, Smolikov S, Gu Y, Schumacher JM, Colaiácovo MP.
LAB-1 antagonizes the Aurora B kinase in C. elegans.
Genes Dev. 2008 22(20) 2869-85 
[ PubMed ID = 18923084 ] [ RRC reference ]