Mutants (Isolated)

tm1782

Allele Nametm1782
Sequence NameC16D6.2
CGC Namenpr-4
Worm BaseAllele Name tm1782
CGC Name npr-4
Sequence C16D6.2
Phenotypehomozygous viable. Dr. W. Schafer: fertile, locomotion grossly normal. Dr. P. Bazzicalupo: fertility reduced. Dr. R.H. Horvitz: wild-type for gross morphology, locomotion and growth rate, does not suppress locomotion defects by flp-18 overexpression.
Mutation site26740/26741-27966/27967 (1226 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(26247..26453, 26546..26663, 26719..27077, 27129..27248, 27297..27450, 27500..27597, 27649..27717))
Map position7.18
Balancer
Map position of balancer
Sequence of primersExtFwd:GGGTGAAGAGAGTTGTGTAC,IntFwd:AAGGATTTCATCGCGTGGTC,ExtRev:ACGTTCTGTACTTCGCTGGT,IntRev:GTACTTCGCTGGTAGGAGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Milward K, Busch KE, Murphy RJ, de Bono M, Olofsson B.
Neuronal and molecular substrates for optimal foraging in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(51) 20672-7 
[ PubMed ID = 22135454 ] [ RRC reference ]

Bhardwaj A, Thapliyal S, Dahiya Y, Babu K.
FLP-18 Functions through the G-Protein-Coupled Receptors NPR-1 and NPR-4 to Modulate Reversal Length in Caenorhabditis elegans.
J. Neurosci. 2018 38(20) 4641-4654 
[ PubMed ID = 29712787 ] [ RRC reference ]

Lim MA, Chitturi J, Laskova V, Meng J, Findeis D, Wiekenberg A, Mulcahy B, Luo L, Li Y, Lu Y, Hung W, Qu Y, Ho CY, Holmyard D, Ji N, McWhirter R, Samuel AD, Miller DM, Schnabel R, Calarco JA, Zhen M.
Neuroendocrine modulation sustains the C. elegans forward motor state.
Elife 2016 5  
[ PubMed ID = 27855782 ] [ RRC reference ]

Frooninckx L, Van Rompay L, Temmerman L, Van Sinay E, Beets I, Janssen T, Husson SJ, Schoofs L.
Neuropeptide GPCRs in C. elegans.
Front Endocrinol (Lausanne) 2012 3 167 
[ PubMed ID = 23267347 ] [ RRC reference ]

Turek M, Besseling J, Spies JP, K├Ânig S, Bringmann H.
Sleep-active neuron specification and sleep induction require FLP-11 neuropeptides to systemically induce sleep.
Elife 2016 5  
[ PubMed ID = 26949257 ] [ RRC reference ]

Cohen M, Reale V, Olofsson B, Knights A, Evans P, de Bono M.
Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling.
Cell Metab. 2009 9(4) 375-85 
[ PubMed ID = 19356718 ] [ RRC reference ]

Yu Y, Zhi L, Guan X, Wang D, Wang D.
FLP-4 neuropeptide and its receptor in a neuronal circuit regulate preference choice through functions of ASH-2 trithorax complex in Caenorhabditis elegans.
Sci Rep 2016 6 21485 
[ PubMed ID = 26887501 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet. 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]