Mutants (Isolated)

tm1779

Allele Nametm1779
Sequence NameEEED8.9
CGC Namepink-1
Worm BaseAllele Name tm1779
CGC Name pink-1
Sequence EEED8.9
Phenotypehomozygous viable. Dr. A. Gartner: no phenotype associating oxidative stress response. Dr. E. Schmidt: J. Biol. Chem. in press.
Mutation site12197/12198-12547/12548 (350 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(10085..10805, 10853..11251, 11299..11528, 11577..11734, 11779..12016, 12068..12199, 12250..12297))
Map position-1.78
Balancer
Map position of balancer
Sequence of primersIntRev:AGCCTCGGGCTTATTAAGGA,IntFwd:TCATTAGGATCTCGCTTGAG,ExtRev:CGCTGAAGGCTCGGATGATG,ExtFwd:GCTAGGTTGGCCATGATAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kang D, Kirienko DR, Webster P, Fisher AL, Kirienko NV.
Pyoverdine, a siderophore from Pseudomonas aeruginosa, translocates into C. elegans, removes iron, and activates a distinct host response.
Virulence 2018 9(1) 804-817 
[ PubMed ID = 29532717 ] [ RRC reference ]

Cho I, Song HO, Cho JH.
Mitochondrial Uncoupling Attenuates Age-Dependent Neurodegeneration in C. elegans.
Mol. Cells 2017 40(11) 864-870 
[ PubMed ID = 29081084 ] [ RRC reference ]

Ahier A, Dai CY, Tweedie A, Bezawork-Geleta A, Kirmes I, Zuryn S.
Affinity purification of cell-specific mitochondria from whole animals resolves patterns of genetic mosaicism.
Nat. Cell Biol. 2018 20(3) 352-360 
[ PubMed ID = 29358705 ] [ RRC reference ]

Lehmann S, Bass JJ, Szewczyk NJ.
Knockdown of the C. elegans kinome identifies kinases required for normal protein homeostasis, mitochondrial network structure, and sarcomere structure in muscle.
Cell Commun. Signal 2013 11 71 
[ PubMed ID = 24060339 ] [ RRC reference ]

Martinez-Finley EJ, Avila DS, Chakraborty S, Aschner M.
Insights from Caenorhabditis elegans on the role of metals in neurodegenerative diseases.
Metallomics 2011 3(3) 271-9 
[ PubMed ID = 21210060 ] [ RRC reference ]

Palikaras K, Tavernarakis N.
Intracellular Assessment of ATP Levels in Caenorhabditis elegans.
Bio Protoc 2016 6(23)  
[ PubMed ID = 28194429 ] [ RRC reference ]

Sämann J, Hegermann J, von Gromoff E, Eimer S, Baumeister R, Schmidt E.
Caenorhabditits elegans LRK-1 and PINK-1 act antagonistically in stress response and neurite outgrowth.
J. Biol. Chem. 2009 284(24) 16482-91 
[ PubMed ID = 19251702 ] [ RRC reference ]

Maulik M, Mitra S, Bult-Ito A, Taylor BE, Vayndorf EM.
Behavioral Phenotyping and Pathological Indicators of Parkinson's Disease in C. elegans Models.
Front Genet 2017 8 77 
[ PubMed ID = 28659967 ] [ RRC reference ]

Palikaras K, Lionaki E, Tavernarakis N.
Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans.
Nature 2015 521(7553) 525-8 
[ PubMed ID = 25896323 ] [ RRC reference ]

Kirienko NV, Ausubel FM, Ruvkun G.
Mitophagy confers resistance to siderophore-mediated killing by Pseudomonas aeruginosa.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(6) 1821-6 
[ PubMed ID = 25624506 ] [ RRC reference ]

Harrington AJ, Hamamichi S, Caldwell GA, Caldwell KA.
C. elegans as a model organism to investigate molecular pathways involved with Parkinson's disease.
Dev. Dyn. 2010 239(5) 1282-95 
[ PubMed ID = 20108318 ] [ RRC reference ]

Kim H, Perentis RJ, Caldwell GA, Caldwell KA.
Gene-by-environment interactions that disrupt mitochondrial homeostasis cause neurodegeneration in C. elegans Parkinson's models.
Cell Death Dis 2018 9(5) 555 
[ PubMed ID = 29748634 ] [ RRC reference ]

Luz AL, Godebo TR, Smith LL, Leuthner TC, Maurer LL, Meyer JN.
Deficiencies in mitochondrial dynamics sensitize Caenorhabditis elegans to arsenite and other mitochondrial toxicants by reducing mitochondrial adaptability.
Toxicology 2017 387 81-94 
[ PubMed ID = 28602540 ] [ RRC reference ]

Martinez BA, Petersen DA, Gaeta AL, Stanley SP, Caldwell GA, Caldwell KA.
Dysregulation of the Mitochondrial Unfolded Protein Response Induces Non-Apoptotic Dopaminergic Neurodegeneration in C. elegans Models of Parkinson's Disease.
J. Neurosci. 2017 37(46) 11085-11100 
[ PubMed ID = 29030433 ] [ RRC reference ]

Luz AL, Rooney JP, Kubik LL, Gonzalez CP, Song DH, Meyer JN.
Mitochondrial Morphology and Fundamental Parameters of the Mitochondrial Respiratory Chain Are Altered in Caenorhabditis elegans Strains Deficient in Mitochondrial Dynamics and Homeostasis Processes.
PLoS ONE 2015 10(6) e0130940 
[ PubMed ID = 26106885 ] [ RRC reference ]

Bornhorst J, Chakraborty S, Meyer S, Lohren H, Brinkhaus SG, Knight AL, Caldwell KA, Caldwell GA, Karst U, Schwerdtle T, Bowman A, Aschner M.
The effects of pdr1, djr1.1 and pink1 loss in manganese-induced toxicity and the role of α-synuclein in C. elegans.
Metallomics 2014 6(3) 476-90 
[ PubMed ID = 24452053 ] [ RRC reference ]

Bess AS, Crocker TL, Ryde IT, Meyer JN.
Mitochondrial dynamics and autophagy aid in removal of persistent mitochondrial DNA damage in Caenorhabditis elegans.
Nucleic Acids Res. 2012 40(16) 7916-31 
[ PubMed ID = 22718972 ] [ RRC reference ]

Bess AS, Leung MC, Ryde IT, Rooney JP, Hinton DE, Meyer JN.
Effects of mutations in mitochondrial dynamics-related genes on the mitochondrial response to ultraviolet C radiation in developing Caenorhabditis elegans.
Worm 2013 2(1) e23763 
[ PubMed ID = 24058863 ] [ RRC reference ]

Schiavi A, Maglioni S, Palikaras K, Shaik A, Strappazzon F, Brinkmann V, Torgovnick A, Castelein N, De Henau S, Braeckman BP, Cecconi F, Tavernarakis N, Ventura N.
Iron-Starvation-Induced Mitophagy Mediates Lifespan Extension upon Mitochondrial Stress in C. elegans.
Curr. Biol. 2015 25(14) 1810-22 
[ PubMed ID = 26144971 ] [ RRC reference ]

Shen Q, Yamano K, Head BP, Kawajiri S, Cheung JT, Wang C, Cho JH, Hattori N, Youle RJ, van der Bliek AM.
Mutations in Fis1 disrupt orderly disposal of defective mitochondria.
Mol. Biol. Cell 2014 25(1) 145-59 
[ PubMed ID = 24196833 ] [ RRC reference ]