Mutants (Isolated)

tm1766

Allele Nametm1766
Sequence NameY4C6A.2
CGC Namemgl-3
Worm BaseAllele Name tm1766
CGC Name mgl-3
Sequence Y4C6A.2
Phenotypehomozygous viable. Dr. I. Mori: normal thermotaxis. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. Y. Jin: no movement phenotype, grows well.
Mutation site13745/13746-14553/14554 (808 bp deletion)
ChromosomeIV
Putative gene structurejoin(11313..11629, 13232..13418, 13968..14293, 14612..14752, 15951..16204, 16256..16480, 16864..17158, 17720..17797, 17845..17950, 18363..18479, 18525..18647, 18951..19271, 19392..19514)
Map position1.67
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCGTCACTCGAGTGATTCA,IntFwd:CATACTCTCCGGGACTAATA,ExtRev:AAAGCATATGCTGGCACGAT,IntRev:CTCCACGAGCCTTCCGTGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dillon J, Franks CJ, Murray C, Edwards RJ, Calahorro F, Ishihara T, Katsura I, Holden-Dye L, O'Connor V.
Metabotropic Glutamate Receptors: MODULATORS OF CONTEXT-DEPENDENT FEEDING BEHAVIOUR IN C. ELEGANS.
J. Biol. Chem. 2015 290(24) 15052-65 
[ PubMed ID = 25869139 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr. Biol. 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab. 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]