Mutants (Isolated)

tm1766

Allele Nametm1766
BalanceNot Required
OutCrossNot Accepted
Sequence NameY4C6A.2
Gene Namemgl-3
Worm BaseAllele Name tm1766
Gene Name mgl-3
Sequence Y4C6A.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I. Mori: normal thermotaxis. Dr. K. Ashrafi: normal Sudan Black B staining. Dr. Y. Jin: no movement phenotype, grows well.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13745/13746-14553/14554 (808 bp deletion)
ChromosomeIV
Putative gene structurejoin(11313..11629, 13232..13418, 13968..14293, 14612..14752, 15951..16204, 16256..16480, 16864..17158, 17720..17797, 17845..17950, 18363..18479, 18525..18647, 18951..19271, 19392..19514)
Map position1.67
Balancer
Map position of balancer
Sequence of primersExtFwd:TGCGTCACTCGAGTGATTCA,ExtRev:AAAGCATATGCTGGCACGAT,IntFwd:CATACTCTCCGGGACTAATA,IntRev:CTCCACGAGCCTTCCGTGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M.
Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans.
Nat Commun 2024 15(1) 297 
[ PubMed ID = 38182628 ] [ RRC reference ]

Yeon J, Porwal C, McGrath PT, Sengupta P.
Identification of a spontaneously arising variant affecting thermotaxis behavior in a recombinant inbred Caenorhabditis elegans line.
G3 (Bethesda) 2023 13(10)  
[ PubMed ID = 37572357 ] [ RRC reference ]

Wang M, Witvliet D, Wu M, Kang L, Shao Z.
Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling.
PLoS Genet 2021 17(1) e1009295 
[ PubMed ID = 33428618 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Bhatla N, Droste R, Sando SR, Huang A, Horvitz HR.
Distinct Neural Circuits Control Rhythm Inhibition and Spitting by the Myogenic Pharynx of C. elegans.
Curr Biol 2015 25(16) 2075-89 
[ PubMed ID = 26212880 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J Neurosci 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]

Dillon J, Franks CJ, Murray C, Edwards RJ, Calahorro F, Ishihara T, Katsura I, Holden-Dye L, O'Connor V.
Metabotropic Glutamate Receptors: MODULATORS OF CONTEXT-DEPENDENT FEEDING BEHAVIOUR IN C. ELEGANS.
J Biol Chem 2015 290(24) 15052-65 
[ PubMed ID = 25869139 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]