Mutants (Isolated)

tm1756

Allele Nametm1756
Sequence NameK10G9.3
CGC Namepad-2
Worm BaseAllele Name tm1756
CGC Name pad-2
Sequence K10G9.3
Phenotypehomozygous viable
Mutation site2083/2084-3472/3473 (1389 bp deletion)
ChromosomeIII
Putative gene structurejoin(2432..2801, 3001..3139, 3196..3438, 3833..4181, 4472..4645)
Map position2.23
Balancer
Map position of balancer
Sequence of primersExtRev:GCAGACTCCACTAAAGGGAA,IntRev:GGGAAAGAGCCTATCTTACT,ExtFwd:GAAGGCGCATGATGGGTTCT,IntFwd:TGGGTTCTGCCACGAGCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]